Informations

Comment se produisent réellement les mutations ?

Comment se produisent réellement les mutations ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

La réplication de l'ADN semble si mécanique - l'ADN polymérase court juste le long du brin matrice. Je ne comprends tout simplement pas comment des mutations peuvent survenir. En ce qui concerne les substitutions, je comprends qu'un mauvais nucléotide peut simplement se lier et que ce ne sera pas une liaison aussi forte qu'avec la base complémentaire, mais je suppose que cela peut arriver. Cependant, en ce qui concerne les mutations telles que les insertions ou les suppressions, je ne comprends pas comment l'ADN polymérase pourrait simplement sauter une section de l'ADN ou ajouter des bases supplémentaires. La translocation chromosomique me semble également un mystère - presque comme si la cellule croyait qu'elle devrait subir une méiose mais avec les mauvais chromosomes appariés et cela ne se produit qu'avec une seule paire…

Je me rends compte que c'est une question assez large, mais toute information sur le mécanisme de la façon dont les mutations se produisent serait très appréciée :)


La mutation de l'ADN peut être causée par une source exogène ou endogène. De nombreux facteurs externes comme l'irradiation ou les produits chimiques induisent des mutations. Certaines mutations endogènes résultent d'un stress oxydatif, d'une réparation insuffisante de l'ADN ou de mutations spontanées au niveau moléculaire.

Il existe de nombreux mécanismes pour la réparation de l'ADN, comme la réparation par excision de bases, la réparation par excision de nucléotides, la jonction d'extrémité homologue ou non homologue (Löffler, Biochimie et Pathobiochimie). Mais il est plus difficile pour la cellule de réparer la mutation si elle est présente dans les deux brins d'ADN. D'après ta deuxième question :

L'ADN polymérase pourrait simplement sauter une section de l'ADN ou ajouter des bases supplémentaires

L'ADN polymérase ne peut pas reconstruire ce qui était le brin d'origine ou l'orientation du brin. Pour prévenir la mort cellulaire, certains mécanismes de réparation de l'ADN incluent l'altération du génome. L'ADN polymérase peut lire et la mutation sera répliquée lorsque la cellule se divise. Par conséquent, la question clé est de savoir comment les effets de la mutation influencent la capacité de la cellule à survivre.


Comment se produisent réellement les mutations ? - La biologie

Les mutations peuvent être bénéfiques, neutres ou nocives pour l'organisme, mais les mutations n'« essaient » pas de fournir ce dont l'organisme « a besoin ». Les facteurs environnementaux peuvent influencer le taux de mutation, mais on ne pense généralement pas qu'ils influencent la direction de la mutation. Par exemple, l'exposition à des produits chimiques nocifs peut augmenter le taux de mutation, mais ne provoquera pas plus de mutations qui rendront l'organisme résistant à ces produits chimiques. À cet égard, les mutations sont aléatoires et le fait qu'une mutation particulière se produise ou non n'est pas lié à l'utilité de cette mutation.

Par exemple, aux États-Unis, où les gens ont accès à des shampooings contenant des produits chimiques qui tuent les poux, nous avons beaucoup de poux résistants à ces produits chimiques. Il y a deux explications possibles à cela :

Hypothèse A : Hypothèse B :
Les souches résistantes de poux ont toujours été présentes et sont juste plus fréquentes maintenant parce que tous les poux non résistants sont morts d'une mort savonneuse. L'exposition au shampooing contre les poux a en fait provoqué des mutations pour la résistance au shampooing.

Les scientifiques pensent généralement que la première explication est la bonne et que les mutations dirigées, la deuxième explication possible reposant sur une mutation non aléatoire, n'est pas correcte.

Les chercheurs ont réalisé de nombreuses expériences dans ce domaine. Bien que les résultats puissent être interprétés de plusieurs manières, aucune ne soutient sans ambiguïté la mutation dirigée. Néanmoins, les scientifiques continuent de faire des recherches qui fournissent des preuves pertinentes à cette question.

De plus, des expériences ont clairement montré que de nombreuses mutations sont en fait aléatoires et ne se sont pas produites parce que l'organisme a été placé dans une situation où la mutation serait utile. Par exemple, si vous exposez des bactéries à un antibiotique, vous observerez probablement une prévalence accrue de résistance aux antibiotiques. Esther et Joshua Lederberg ont déterminé que bon nombre de ces mutations pour la résistance aux antibiotiques existaient dans la population avant même que la population ne soit exposée à l'antibiotique et que l'exposition à l'antibiotique n'a pas provoqué l'apparition de ces nouveaux mutants résistants.

L'expérience Lederberg
En 1952, Esther et Joshua Lederberg ont réalisé une expérience qui a permis de montrer que de nombreuses mutations sont aléatoires et non dirigées. Dans cette expérience, ils ont capitalisé sur la facilité avec laquelle les bactéries peuvent être cultivées et entretenues. Les bactéries se développent en colonies isolées sur des plaques. Ces colonies peuvent être reproduites à partir d'une plaque d'origine vers de nouvelles plaques en "estampant" la plaque d'origine avec un chiffon, puis en estampant les plaques vides avec le même chiffon. Les bactéries de chaque colonie sont ramassées sur le tissu puis déposées sur les nouvelles plaques par le tissu.

Esther et Joshua ont émis l'hypothèse que les souches de bactéries résistantes aux antibiotiques ayant survécu à une application d'antibiotiques avaient la résistance avant leur exposition aux antibiotiques, et non à la suite de l'exposition. Leur montage expérimental est résumé ci-dessous :

Lorsque la plaque d'origine est lavée avec de la pénicilline, les mêmes colonies (celles en position X et Y) vivent — même si ces colonies sur la plaque d'origine n'ont jamais rencontré de pénicilline auparavant.


En quoi la mutation est-elle un processus aléatoire ?

OUI, il est vrai que les mutations sont aléatoires et donc, elles peuvent se produire à tout moment sans aucun but, raison ou modèle défini dans le corps biologique.

Selon la théorie neutre de Kimura, les changements dans les séquences d'ADN au sein et entre les espèces n'ont qu'un effet sélectif mineur ou nul. Ces différences mineures sont apparues principalement à travers les divers processus aléatoires appelés mutations au niveau des nucléotides (niveau moléculaire de l'ADN).

Les mutations sont connues pour se produire de manière aléatoire et régulière, et donc à long terme, c'est l'une des principales raisons de la différenciation et de l'évolution au sein et entre les espèces.

La mutation est en effet aléatoire et non dirigée car lors de la division cellulaire c'est-à-dire soit lors de la mitose ou de la méiose, soit lors de l'exposition aux rayonnements UV, réplication virale, etc. une altération ou suppression accidentelle de la séquence nucléotidique au cours du processus de duplication de l'ADN (gène) se produit .

Au cours du processus de division cellulaire, c'est-à-dire pendant la méiose dans les cellules gamétiques et la mitose dans les cellules somatiques, les cellules pendant sa division cellulaire, tout son ADN est d'abord dupliqué, puis la moitié du contenu en ADN va à une cellule fille et demi à l'autre cellule fille.

Ainsi, la cellule essaie toujours de se dupliquer parfaitement. La machinerie moléculaire génomique comprend l'enzyme ADN polymérase qui corrige le processus de réplication de l'ADN et assure la duplication correcte du nouveau brin d'ADN à partir du brin d'ADN matrice.

Mais toujours dans certains cas, chaque fois qu'une cellule se divise, il se produit occasionnellement (rarement) de petites erreurs de copie qui ne sont pas corrigées. Tels que A (adénine) peuvent être insérés dans le nouveau brin, plutôt que G (guanine).

En outre, d'autres facteurs tels que l'exposition aux rayons UV et aux produits chimiques nocifs peuvent également provoquer la création d'un radical libre qui interagit avec les bases de l'ADN et les oxyde. Ces bases oxydées ne s'apparient pas correctement lors de la réplication, provoquant diverses mutations.

Également en raison du rayonnement UV, la formation de dimère de cyclobutane pyrimidine peut se produire occasionnellement dans les segments d'ADN (génome). C'est ce qu'on appelle la mutation dimérisante qui empêche les pyrimidines de s'apparier de bases et empêche également la réplication de l'ADN.

De plus, nous savons que les virus n'ont pas de génome d'ADN ou d'ARN stable et qu'ils changent donc continuellement en raison de la sélection génétique. Ils subissent des changements génétiques subtils par mutation et des changements génétiques majeurs par recombinaison.

Ainsi, lorsque les virus infectent le corps d'animaux supérieurs, ils répliquent des particules d'ADN viral à l'intérieur de ce génome animal, ce qui peut parfois conduire à des mutations dirigées ou principalement aléatoires.

Tels de tous les processus mentionnés ci-dessus sont des cas qui se produisent rarement conduisant à des mutations aléatoires.

REMARQUE: Dans certains cas, il convient également de noter que l'affirmation selon laquelle les mutations sont aléatoires est à la fois profondément vraie et profondément fausse en même temps. Dans la plupart des cas, les mutations sont aléatoires et moins dirigées (non aléatoires).


Pourquoi la mutation n'est-elle pas aléatoire et la sélection naturelle non ?

Oui, il est vrai que la mutation est aléatoire, mais la sélection naturelle ne l'est pas.

C'est parce qu'une seule occurrence de mutation peut se produire de manière aléatoire sans but ni but précis. Tandis que d'autre part, une seule occurrence de sélection naturelle agissant sur les différentes mutations a provoqué des variations génétiques du génome pour faire ressortir une adaptation notable au corps biologique.

Les mutations peuvent se produire de manière aléatoire, tandis que la sélection naturelle est dirigée par les forces mutationnelles pour agir sur le génome afin de faire ressortir les changements évolutifs du corps biologique sur le long terme.

Cela signifie que divers types de mutations se produisent pendant des centaines à des milliers d'années, et la sélection naturelle est un facteur évolutif qui agit après l'apparition de telles mutations pour faire ressortir ce qui est le type d'adaptation bénéfique la plupart du temps.

La sélection naturelle sélectionne de manière sélective uniquement les mutations qui aident à la survie et à la reproduction des descendants à transmettre aux générations suivantes. Les moins aptes et inaptes sont détruits.

Ainsi, les variantes génétiques dues à des mutations qui aident à la survie et à la reproduction sont beaucoup plus susceptibles de devenir courantes que les variantes qui ne le font pas.

Pour mieux comprendre, vous pouvez considérer la sélection naturelle comme étant aléatoire et contenant à la fois des composants aléatoires et non aléatoires. Cependant, dans l'autre cas, les changements génétiques (ou mutations) sont filtrés par sélection naturelle pour se produire de manière aléatoire.


Les bactéries enseignent aux biologistes l'évolution

Les microbes étaient initialement considérés comme la preuve de l'indépendance des processus mutationnels et des environnements sélectifs. L'expérience de Luria-Delbruck (1943) a démontré que des mutations bactériennes à la résistance aux phages peuvent se produire avant l'exposition aux phages [2], et les Lederberg ont montré des résultats similaires pour la résistance à de nombreux antibiotiques [3]. Cependant, la découverte de la réponse SOS aux dommages à l'ADN et de la mutagenèse qui l'accompagne [4-7] dans le monde post-ADN de la génétique moléculaire a commencé à éroder l'air du temps de la mutation aléatoire. Harrison Echols pensait que la réponse SOS conférait une « évolution inductible » [8], faisant écho à la suggestion similaire de Barbara McClintock inspirée par SOS d'adaptation par des poussées régulées d'instabilité du génome [9]. Mais la mutagenèse SOS pourrait être un sous-produit inévitable de la réparation de l'ADN, et la réparation haute fidélité pourrait être difficile à faire évoluer, selon beaucoup. La proposition ultérieure de John Cairns de mutagenèse « dirigée » ou « adaptative » dans le stress de la famine Escherichia coli [10, 11] ont recadré le caractère aléatoire supposé de la mutation comme un problème passionnant non encore résolu. La mutagenèse qu'ils ont étudiée dans l'environnement non létal de la famine est maintenant connue pour refléter la mutagenèse induite par le stress - une mutation régulée à la hausse par les réponses au stress. Son ou ses mécanismes moléculaires, examinés ici, démontrent la régulation de la mutagenèse. Des mécanismes similaires sont maintenant décrits de la bactérie à l'homme, suggérant que la mutagenèse régulée peut être la règle, et non l'exception (discutée ici et revue plus en détail, [12]).

Réparation de cassure d'ADN mutagène induite par le stress dans E. coli

Les cassures double brin de l'ADN (DSB) se produisent spontanément dans environ 1% des cas de prolifération E. coli [13, 14]. En non stressé E. coli, la réparation DSB par recombinaison homologue (HR) est d'une fidélité relativement élevée. Cependant, l'activation de la réponse générale au stress, par exemple, par la famine, fait basculer un interrupteur, ce qui rend la réparation DSB mutagène [15, 16]. Ce processus de réparation mutagène des cassures (MBR) provoque des mutations préférentiellement lorsque les cellules sont mal adaptées à leur environnement - lorsqu'elles sont stressées - et, comme l'indique la modélisation [17-20], peut accélérer l'adaptation.

Au moins trois réponses au stress coopèrent pour augmenter la mutagenèse dans la famine E. coli. La réponse au stress membranaire contribue à la formation de DSB à certains loci [21] la réponse SOS régule à la hausse les ADN polymérases sujettes aux erreurs utilisées dans l'un des deux mécanismes MBR [22-24] et la réponse générale au stress autorise l'utilisation ou la persistance de erreurs commises par ces ADN polymérases dans la réparation des DSB [15, 16]. L'exigence de réponses multiples au stress indique que les cellules vérifient quelques conditions environnementales avant de basculer vers la mutation [25]. E. coli Le MBR est un modèle de principes généraux de mutation de la bactérie à l'homme : la régulation de la mutation dans le temps, par les réponses au stress, et sa restriction dans l'espace génomique, limité à de petites régions génomiques, dans le cas du MBR, proches des cassures d'ADN. Nous regardons le MBR, puis d'autres mécanismes de mutation chez les microbes et les organismes multicellulaires, qui partagent ces caractéristiques communes.

Mécanismes MBR

Deux mécanismes MBR distincts mais liés se produisent dans la famine E. coli, et les deux nécessitent l'activation de la réponse générale/de famine. De plus, les deux se produisent sans stress de famine si la réponse générale au stress est artificiellement régulée à la hausse [15, 16], indiquant que la réponse au stress elle-même sans stress réel est suffisante. Le MBR de recombinaison homologue (dirigé par l'homologie) (HR-MBR) génère des substitutions de bases et de petits indels via des erreurs d'ADN-polymérase lors de la synthèse de réparation DSB (Fig. 1A-1F). La MBR microhomologue provoque des amplifications et d'autres réarrangements chromosomiques bruts (GCR) [26-28], très probablement par réplication induite par rupture induite par microhomologie (MMBIR) [28, 29] (Fig 1A-1C, 1G et 1H). Les deux voies MBR remettent en question les hypothèses traditionnelles sur la nature « hasardeuse » des mutations.

(a–c) La nucléase RecBCD charge la protéine RecA HR sur l'ADNsb, de la même manière que le BRCA2 humain charge l'appariement de bases RAD51 avec un brin d'ADN duplex identique (gris, par exemple, un chromosome frère). Lignes parallèles, brins d'ADN appariés en bases. La synthèse de réparation (lignes pointillées) est commutée en mode mutagène par la réponse générale au stress (sigma S). Les erreurs d'ADN polymérase (d, violet X) génèrent des indels (e, violet XX) et des substitutions de bases (f, violet XX). Le MBR microhomologue nécessite l'ADN Pol I pour la commutation de modèle vers des régions contenant une microhomologie (g), d'aussi peu que quelques paires de bases, et initie la réplication, créant des réarrangements génomiques (h) un segment de chromosome dupliqué (flèches bleues) est montré ici. Les nombres encerclés et ombrés indiquent les trois événements principaux dans HR-MBR : ① un DSB et sa réparation par HR, ② la réponse SOS (rose) et ③ la réponse générale au stress (bleu). Notez que le HR-MBR (d–f, violet) nécessite à la fois la réponse SOS (②, rose, qui régule à la hausse l'ADN Pol IV sujet aux erreurs, nécessaire pour le HR-MBR) et la réponse générale au stress (③, bleu), mais Le MBR microhomologue (g–h, bleu) nécessite la réponse générale au stress mais pas le SOS (③, bleu). Figure modifiée de [12]. HR, MBR de recombinaison homologue, ADNsb de réparation de cassure mutagène, ADN simple brin.

Les deux mécanismes MBR sont initiés par un DSB et nécessitent des protéines de réparation HR DSB (Fig 1, ①) [15, 28, 30-33]. Les premières étapes reflètent la réparation standard du HR DSB : la nucléase RecBCD traite les extrémités du DSB et charge la protéine RecA HR (figures 1A et 1B). Ensuite, le filament de nucléoprotéine RecA-ADN peut activer la réponse SOS (Fig 1, ② rose), qui est requise pour le HR-MBR mais pas pour le MBR microhomologue. RecA facilite également l'invasion des brins - le contact initial entre la molécule d'ADN brisée et un chromosome frère identique à partir duquel la réparation est paramétrée (Fig 1C). Dans les cellules non stressées, cet intermédiaire conduit à une réparation HR de haute fidélité. Cependant, si la réponse générale au stress est activée, la réparation s'effectue via l'une des deux voies mutagènes (Fig 1D-1H, ③). Dans la réparation HR-DSB, les erreurs générées par les ADN polymérases IV (DinB), V (UmuDC) et II (PolB) sujettes aux erreurs s'accumulent dans les voies de synthèse de réparation pendant la réparation HR (Fig 1D) [22 , 23, 34]. L'activation de la réponse générale au stress autorise l'utilisation de ces polymérases et/ou empêche la suppression des erreurs qu'elles génèrent : substitutions de bases et petits indels (Fig 1E, 1F) [35, 36] qui sont localisés principalement dans des clusters/hotspots d'environ 100 ko autour de l'emplacement original du DSB [30]. Le MBR microhomologue nécessite de l'ADN Pol I, qui est proposé pour promouvoir la commutation de modèle dépendant de la microhomologie pendant la synthèse de réparation pour générer des GCR (Fig 1G et 1H) [28]. Des mécanismes MMBIR similaires sont proposés pour sous-tendre de nombreux GCR dirigés par les DSB dans les maladies génétiques humaines et les cancers [28, 29, 37].

Régulation de la réponse au stress de E. coli MBR

Les mécanismes MBR sensibles à l'environnement et régulés dans le temps remettent en question les hypothèses de longue date sur la nature constante et progressive de la mutagenèse et son aveuglement à l'adéquation environnementale d'un organisme, ou son absence, montrant que la mutagenèse est étroitement régulée par les intrants environnementaux. La réponse générale au stress contrôle le basculement entre la réparation DSB haute fidélité ou mutagène [15, 16]. Cette réponse au stress, contrôlée par le facteur sigma alternatif σ S , est activée par la famine, le froid, l'acide, les antibiotiques, l'oxydation et les stress osmotiques, entre autres. Lors d'une réponse générale au stress, l'activateur transcriptionnel σ S augmente la transcription de centaines de gènes (environ 10 % de tous les E. coli gènes) qui fournissent une gamme de fonctions protectrices (revue, [38]). Nous ne savons pas exactement comment la réponse générale au stress favorise la mutagenèse. Deux possibilités sont les suivantes. Premièrement, la réponse générale au stress régule légèrement à la hausse la Pol IV sujette aux erreurs au-dessus des niveaux induits par le SOS [39]. Cela pourrait être l'étape de limitation du débit. De plus, la réponse générale au stress régule négativement les enzymes de réparation des mésappariements (MMR) MutS et MutH [40, 41]. Le spectre de mutation HR-MBR est similaire à celui des souches déficientes en MMR non stressées [35, 36, 42], ce qui suggère que le MMR devient transitoirement limitant pendant HR-MBR [36, 43, 44]. D'autres cibles σ S sont également plausibles, notamment la régulation négative de l'ADN réplicatif haute fidélité Pol III. Ensemble, ces observations suggèrent un modèle dans lequel la réponse générale au stress permet aux polymérases sujettes aux erreurs de participer à la réparation des DSB et/ou permet aux erreurs introduites par ces polymérases d'échapper à la réparation des mésappariements.

Au moins deux autres réponses au stress contribuent également à l'un ou aux deux mécanismes MBR. La réponse SOS aux dommages à l'ADN est requise pour le HR-MBR [45] mais pas le MBR microhomologue [22].La réponse SOS est détectée dans environ 25% des cellules avec un DSB réparable [13] et vient donc automatiquement avec le DSB qui initie le MBR. (Les 75 % sans SOS peuvent se réparer assez rapidement pour éviter le SOS [13].) La réponse SOS arrête la division cellulaire et active la tolérance aux dommages de l'ADN et les voies de réparation. Le rôle principal de la réponse SOS dans HR-MBR est la régulation à la hausse des ADN polymérases IV et V et éventuellement II sujettes aux erreurs. Dans certains tests, la production de Pol IV restaure complètement la mutagenèse dans les cellules SOS-défectueuses [23]. Dans d'autres, Pols II et V contribuent également à la mutagenèse [16, 34, 46]. Enfin, la réponse au stress membranaire, régulée par σ E , favorise le MBR à certains loci en jouant un rôle dans la formation spontanée de DSB par un mécanisme inconnu (voir « Localisation des mutations dépendantes du MBR ») [21]. La réponse au stress membranaire est déclenchée par une accumulation de protéines d'enveloppe dépliées causée par la chaleur et d'autres facteurs de stress [47] et semble donc coupler ces facteurs de stress à la mutagenèse.

Un criblage à l'échelle du génome a révélé un réseau de 93 gènes requis pour le MBR induit par le stress dû à la famine [25]. De manière frappante, plus de la moitié participent à la détection ou à la signalisation de divers types de stress et agissent en amont de l'activation des principaux régulateurs de réponse au stress, qui sont des hubs dans le réseau MBR. Pendant le stress de famine, au moins 31 gènes fonctionnent en amont de (dans l'activation de) la réponse générale au stress. La plupart codent pour des protéines utilisées dans le transfert d'électrons et d'autres voies métaboliques, ce qui suggère qu'elles pourraient être les principaux capteurs du stress dû à la famine. De plus, au moins six gènes sont requis pour l'activation de la réponse SOS pendant le MBR, et au moins 33 gènes du réseau MBR sont requis pour l'activation de la réponse au stress membranaire. Les 93 gènes MBR forment un réseau hautement connecté basé sur des interactions protéine-protéine avec les trois régulateurs de réponse au stress (σ S , RecA/LexA et σ E ) en tant que hubs de réseau non redondants [25]. Le réseau MBR met en évidence l'importance d'une régulation étroite et combinatoire de la réponse au stress de la mutagenèse en réponse à de multiples entrées.

Généralité de la mutation favorisée par la réponse générale au stress

Dans E. coli, la mutagenèse S-dépendante a une signature mutationnelle distincte de celle observée dans les études d'accumulation de mutations (MA) à faible stress et la mutagenèse dépendante de la génération [34, 35, 42, 48]. Il est important de noter que la diversité des nucléotides dans les génomes des E. coli et d'autres bactéries sont mieux décrites par la signature S -dépendante que la signature observée dans les études d'AMM [48]. Plus précisément, les mutations dépendantes de σS et celles observées dans les espèces existantes ont des rapports de transitions sur transversions beaucoup plus élevés que ceux observés dans les expériences de MA ou attendus par hasard. Cela suggère qu'une partie importante des mutations adaptatives chez les bactéries proviennent de mécanismes de mutation induits par le stress dépendant de σ S tels que MBR [48]. De plus, la modélisation mathématique suggère que la mutagenèse régulée par la réponse au stress, telle que la MBR, favorise l'adaptation dans des environnements changeants [17-20]. Les organismes qui codent pour des mécanismes de mutagenèse régulés peuvent avoir une capacité d'évolution accrue, ce qui favoriserait l'évolution et le maintien de tels mécanismes par sélection de second ordre [17, 19, 20].

Localisation des mutations dépendantes du MBR

Le MBR génère des mutations dans des points chauds proches du site de la DSB initiatrice, et non à des emplacements aléatoires dans le génome [30, 49]. Le hotspotting près des DSB est mieux décrit pour le HR-MBR initié par les DSB modifiés à divers sites du chromosome bactérien [30]. Les mutations sont plus fréquentes dans la première paire de kilobases (ko) de chaque côté du DSB, puis tombent à des niveaux proches du bruit de fond à environ 60 Ko de la rupture, avec une faible zone chaude à longue distance d'environ 1 Mo du site DSB . Ce modèle de mutations soutient le modèle selon lequel la plupart des mutations dépendantes du MBR résultent d'erreurs de l'ADN polymérase lors de la synthèse de réparation HR, et le reste survient lors d'une réplication induite par rupture plus sujette aux erreurs de processus. L'observation que des mutations se produisent à proximité des DSB ne suggère pas, en soi, que les mutations sont plus susceptibles de se produire dans certaines régions génomiques ou dans des emplacements liés au « besoin » adaptatif d'un organisme. Cependant, cela suggère que la distribution des mutations est susceptible de refléter la distribution des DSB, et les éléments de preuve suivants suggèrent que les distributions des DSB peuvent être non aléatoires et refléter l'utilité potentielle des gènes dans des environnements particuliers.

Les sources et les distributions des DSB spontanées sont mal comprises dans tous les organismes (revue, [14]), mais nous avons quelques indices sur les origines des DSB qui conduisent à la MBR. Premièrement, les hybrides transcriptionnels ARN-ADN (boucles R) sont une source de DSB favorisant le MBR [50]. Les boucles R ont été impliquées dans la formation de DSB dans de nombreux systèmes expérimentaux, bien que le ou les mécanismes exacts de la rupture de l'ADN ne soient pas résolus (examiné, [51]). Bien que la distribution des boucles R n'ait pas été évaluée de manière approfondie dans E. coli, les boucles R ont tendance à être biaisées vers les gènes hautement transcrits, les promoteurs et les gènes d'ARN non codants [52-54] et pourraient donc cibler les DSB et les mutations sur ces sites. De plus, l'activation de la réponse au stress membranaire σ E est requise pour la formation des DSB dans certains tests et pourrait cibler les DSB dans l'espace génomique [21]. Le mécanisme par lequel la réponse au stress σ E provoque les DSB est inconnu, mais une possibilité est que la transcription activée par σ E provoque directement les DSB (plutôt que via la régulation à la hausse ou à la baisse des produits géniques), via une boucle R dépendante ou autre mécanisme dépendant de la transcription. Les boucles R et la réponse au stress σ E pourraient diriger les DSB, et donc les mutations, vers des régions du génome ayant un potentiel plus adaptatif pour un environnement donné : gènes transcrits et éléments régulateurs (promoteurs et petits ARN régulateurs).

De plus, des mutations dépendantes du MBR peuvent se produire en grappes [55]. Lorsqu'une mutation induite par MBR survient, la probabilité de trouver une autre mutation sur des sites voisins distants de 10 kb est environ 10 3 fois plus élevée que si la première mutation n'avait pas eu lieu [55], et ce n'est pas vrai pour un site distant non lié dans le génome [43], indiquant que les mutations proches ne sont pas des événements indépendants. C'est-à-dire que les mutations liées semblent se produire simultanément, dans des événements MBR uniques. De tels clusters devraient favoriser une évolution concertée en introduisant simultanément des changements dans plusieurs domaines d'une protéine ou de sous-unités d'une machine protéique complexe [15, 20, 55]. Parce que de multiples mutations sont souvent nécessaires pour que de nouvelles fonctions émergent, et souvent, les états mutés intermédiaires sont moins adaptés et contre-sélectionnés, la façon dont les machines à protéines complexes évoluent est un problème de longue date [56]. Des clusters similaires ont été identifiés dans de nombreux organismes [57] et dans les génomes cancéreux, dans lesquels les clusters de mutations sont appelés kataegis, grec pour (mutation) tempêtes [58-60]. Les mécanismes de localisation et de cooccurrence des mutations révélés par le MBR dans E. coli ont guidé une compréhension plus mécaniste de la façon dont les grappes de mutations se produisent à travers l'arbre de la vie.

Analyses de E. coli les lignées d'accumulation de mutations et les isolats naturels indiquent que les taux de mutations locales varient d'environ un ordre de grandeur sur une échelle d'environ 10 à 100 kb [61, 62]. Il est possible, voire probable, que la localisation des mutations dépendantes du DSB et les groupes de mutations co-occurrents caractéristiques de la MBR contribuent de manière importante à cette non-uniformité du taux de mutation. Des degrés similaires de variation des taux de mutation locaux ont été rapportés pour d'autres bactéries [63], levures [64] et mammifères (souris, humains et autres primates [65, 66]) et pourraient également résulter de mécanismes de mutation de type MBR. Une analyse plus poussée des isolats naturels, en mettant l'accent sur l'identification de grappes de variants mononucléotidiques coségrégeants, pourrait indiquer la fréquence des grappes de mutations dépendantes du MBR et la façon dont elles façonnent les génomes.

Les mécanismes moléculaires de la MBR révèlent de nombreuses façons par lesquelles les mutations ne se produisent pas uniformément ou indépendamment les unes des autres dans l'espace génomique. Des travaux supplémentaires sont nécessaires pour évaluer pleinement si le mécanisme MBR ou les génomes eux-mêmes ont évolué pour biaiser les mutations vers des emplacements où ils sont les plus susceptibles d'être bénéfiques, tels que les gènes activement transcrits en réponse au facteur de stress expérimenté.


Évolution de l'isolement reproductif par mutation génique

Selon le concept d'espèce biologique ( Dobzhansky 1937 Mayr 1963), un groupe d'individus est appelé une espèce lorsqu'il est isolé d'autres groupes d'individus par des mécanismes d'isolement avant ou après l'accouplement. Il est donc important de savoir comment la barrière reproductive est générée au niveau génétique. Dans le cas de la polyploïdisation, la barrière reproductive est instantanément générée chez les organismes autofécondants car l'hybride d'un nouveau polyploïde et de son espèce parentale est généralement stérile comme mentionné ci-dessus. Cependant, comment se forme la barrière reproductive en l'absence de réarrangements chromosomiques ? Il existe différents modèles génétiques qui peuvent expliquer l'évolution de l'isolement reproductif. Ici, nous aimerions discuter uniquement des modèles génétiques qui ont été étudiés empiriquement au niveau moléculaire. En pratique, la stérilité ou l'inviabilité des hybrides est un caractère complexe et contrôlé par un grand nombre de gènes ( Coyne 1992), et il est difficile d'étudier l'effet de tous ces gènes simultanément. Par conséquent, la plupart des expérimentateurs extraient un petit nombre de gènes majeurs, puis étudient le mécanisme d'isolement reproductif au niveau moléculaire. Cette approche est certes importante, mais il ne faut pas oublier qu'elle peut conduire à des conclusions biaisées. Notez également que le concept d'espèce biologique n'est pas toujours applicable aux plantes ou aux champignons car ces organismes se reproduisent souvent par autofécondation ou reproduction asexuée et les populations ne sont pas bien définissables ( Rieseberg et Willis 2007). L'isolement reproductif initial est également généralement obtenu par isolement prézygotique plutôt que post-zygotique. Pour cette raison, la spéciation se produit plus facilement chez les plantes et les champignons que chez les animaux.

Au cours des douze dernières années, de nombreux chercheurs ont utilisé le modèle dit Dobzhansky-Muller (DM) (voir ci-dessous) comme ligne directrice pour mener des études expérimentales et interpréter leurs résultats. En pratique, cependant, ce n'est qu'un des nombreux modèles possibles pour l'évolution de l'isolement reproductif, comme cela sera mentionné ci-dessous.

Modèle de spéciation Oka par mutations génétiques en double

L'un des modèles les plus simples est le modèle de spéciation d'Oka (1953, 1957, 1974) par des mutations mortelles se produisant dans des gènes en double. Ne connaissant apparemment pas les articles d'Oka, Werth et Windham (1991) et Lynch et Force (2000) ont proposé essentiellement le même modèle, mieux connu aux États-Unis. Dans ce modèle, le stock de fondation est supposé diverger en deux populations géographiquement isolées (populations 1 et 2) et ces populations évoluent indépendamment ( fig. 4). Il est également supposé que le stock de base d'origine contient deux gènes en double (allèles), UNE0 et B0, qui ont des fonctions redondantes et que dans l'allèle de population 1 UNE0 mute en un allèle mortel, UNE1, et dans l'allèle de population 2 B0 mute en un autre allèle mortel, B2 (voir fig. 4). Si ces événements évolutifs se produisent et que les populations 1 et 2 sont croisées, le génotype hybride sera UNE0UNE1B0B2. Ce génotype produira des gamètes UNE0B0, UNE1B0,UNE0B2, et UNE1B2 chacun avec une probabilité de 1/4 si les deux loci ne sont pas liés. Par conséquent, un quart (UNE1B2) d'entre eux seront stériles.

Modèle Oka de spéciation par mutations génétiques en double. UNE et B sont des gènes en double. UNE0 et B0 sont les allèles normaux d'origine, et UNE1 et B2 sont des mutations mortelles.

Modèle Oka de spéciation par mutations génétiques en double. UNE et B sont des gènes en double. UNE0 et B0 sont les allèles normaux d'origine, et UNE1 et B2 sont des mutations mortelles.

Drosophile des expériences ont montré que le taux de mutations mortelles par locus est d'environ 10 -5 par génération. Par conséquent, la probabilité d'occurrence de la stérilité hybride ne serait pas très faible. Notez que le taux de fixation d'une mutation létale récessive dans l'un des deux loci dupliqués est presque égal au taux de mutation lorsque les tailles effectives des populations locales sont relativement petites (Nei et Roychoudhury 1973). Ces considérations rendent probable le développement d'une barrière reproductive de cette manière.

L'étendue de la stérilité des gamètes augmente évidemment lorsqu'il existe de nombreux ensembles de loci en double. En effet, lorsqu'il y a m ensembles indépendants de loci en double qui contrôlent la formation de spermatozoïdes ou d'ovules, la proportion attendue de gamètes stériles sera de 1 - (3/4) m , qui devient 0,9 pour m = 8 et 0,99 pour m = 16. Par conséquent, ce type de stérilité des gamètes est susceptible de se produire dans la descendance d'un polyploïde nouvellement généré, où il existe un grand nombre de gènes en double. Ces dernières années, cependant, il a été constaté que même les organismes non polyploïdes contiennent un grand nombre de gènes en double à petite échelle (variation du nombre de copies) dans leur génome (par exemple, Redon et al. 2006). Par conséquent, le modèle d'Oka est susceptible de s'appliquer à pratiquement toutes les espèces. En pratique, la relation entre le nombre de gènes létaux et l'étendue de la stérilité masculine ne serait pas aussi simple que mentionné ci-dessus. Lynch et Force (2000) ont suggéré que la divergence fonctionnelle des gènes dupliqués peut augmenter la probabilité d'occurrence de la stérilité hybride.

Dans le riz, Oryza sativa, il existe deux sous-espèces appelées Japonica et Indica, qui a divergé il y a environ 400 000 ans. Ces sous-espèces ont deux gènes en double DPL1 et DPL2, qui codent pour de petites protéines végétales hautement conservées et sont fortement exprimées dans l'anthère mature. Mizuta et al. (2010) ont montré que Japonica porte une fonction (DPL1 + ) et non fonctionnel (DPL2 − ) allèles au DPL1 et DPL2 loci, respectivement. Par contre, Indica a un non fonctionnel (DPL1 − ) et fonctionnel (DPL2 + ) allèles aux deux loci. L'inactivation de l'allèle DPL1 − est causée par une insertion de transposon dans l'un des exons du gène, alors que la non fonctionnalité de DPL2 − est due à la mutation A → G au niveau d'un site d'épissage d'intron. Allèles DPL1 + , DPL1 − , DPL2 + , et DPL2 − correspondent aux allèles UNE0, UNE1, B0, et B2 dans la figure 4, respectivement, et donc, la stérilité partielle de l'hybride entre Japonica et Indica peut s'expliquer par le modèle d'Oka. Un isolement reproductif similaire causé par des mutations géniques en double a été observé entre O. sativa et ses espèces apparentées O. glumaepatula ( Yamagata et al. 2010). Dans ce cas, les gènes impliqués sont les copies de gènes en double S27 et S28 codant pour la protéine ribosomique mitochondriale L27. Il a été montré que le S27 le gène est absent dans O. glumaepatula et le S28 gène de O. sativa contient des mutations non fonctionnelles. Par conséquent, un quart des pollens hybrides n'ont aucun gène fonctionnel, et donc provoquent la stérilité du pollen. Un autre exemple de ce type d'isolement reproductif a été rapporté dans Arabidopsis ( Bikard et al. 2009, voir tableau 1).

En fait, en utilisant des techniques génétiques classiques, Oka (1953, 1974) avait identifié un certain nombre de gènes de stérilité hybrides, apparemment dus à des mutations génétiques en double. À son époque, cependant, aucune technique moléculaire n'était disponible pour étudier les changements évolutifs des gènes, et ses conclusions sont donc restées des conjectures. En ce sens, des études moléculaires récentes ont fourni des preuves empiriques solides pour sa théorie. En fait, Oka (1974) était conscient de la possibilité d'une polyploïdisation ancienne du riz sur la base de l'étude cytogénétique de Sakai (1935) et Nandi (1936).

À ce stade, il convient de noter que UNE1 et B2 dans la figure 4 représentaient des mutations mortelles mais elles peuvent également représenter la perte des gènes en double UNE0 et B0, respectivement, car ils ont le même effet que celui des mutations létales en générant un isolement reproductif. En effet, la formation de nouvelles espèces chez les levures après la duplication du génome dans leur espèce ancestrale ( fig. 2 et 3) peut être expliquée par le modèle d'Oka ( Scannell et al. 2006). Il convient également de noter que la plupart des auteurs qui ont étudié l'hypothèse de la mutation génique en double l'ont appelée à tort le modèle DM au lieu du modèle Oka (par exemple, Werth et Windham 1991 Lynch et Force 2000 Mizuta et al. 2010). Dans le modèle d'Oka, des mutations mortelles ou des pertes de gènes sont les facteurs causaux, et il n'y a pas besoin d'interaction entre UNE1 et B2. Dans le modèle DM, cependant, UNE1 et B2 sont des gènes fonctionnels et une forme particulière d'interaction génique entre les allèles UNE1 et B2 est supposé exister, comme nous le verrons ci-dessous. Dans le modèle DM, la fixation des allèles UNE1 et B2 par sélection positive est également souvent supposée.

Certains auteurs ne sont pas enthousiasmés par l'importance du modèle de spéciation d'Oka. Coyne et Orr (2004) ont déclaré que la polyploïdisation ne se produit pas si souvent chez les espèces animales, ce qui minimise l'importance de ce modèle. Comme mentionné ci-dessus, cependant, des études génomiques récentes indiquent que les duplications de gènes à petite échelle sont abondantes, et il n'y a aucune raison de croire que le modèle Oka est moins important chez les animaux que chez les plantes. Coyne et Orr ont également déclaré que le destin ultime des gènes dupliqués est d'acquérir de nouvelles fonctions géniques plutôt que la non-fonctionnalité. En fait, cette affirmation est incorrecte. Les gènes en double deviennent des pseudogènes beaucoup plus fréquemment qu'ils n'acquièrent de nouvelles fonctions ( Lynch et Force 2000 Nei et Rooney 2005). Pour ces raisons, le modèle Oka peut jouer un rôle important dans la spéciation chez les plantes et les animaux.

Modèle DM d'évolution de l'isolement reproductif

Dans le modèle de spéciation d'Oka, il est nécessaire d'avoir des gènes en double. Cependant, l'isolement reproductif peut être développé sans gènes en double s'il y a deux gènes ou plus qui interagissent négativement les uns avec les autres lorsqu'ils sont réunis dans des hybrides. L'un de ces modèles est le modèle dit DM ( Dobzhansky 1937 Muller 1940, 1942). L'essence de ce modèle est présentée dans la figure 5A. Sur cette figure, deux loci, UNE et B, sont considérés, et UNE0UNE0B0B0 représente le génotype de ces loci dans le stock de base à partir duquel les populations 1 et 2 ont été dérivées. Si ces deux populations sont isolées géographiquement ou écologiquement, il est possible que UNE0 mute en UNE1 dans la population 1 et cet allèle mutant est fixé dans la population par sélection naturelle ou dérive génétique. Génotype UNE0UNE0B0B0 peut alors être remplacé par UNE1UNE1B0B0 sans perte de viabilité et de fertilité ( fig. 5A). De la même manière, B0 peut muter en B2 dans la population 2 et l'allèle mutant peut être fixé. Cependant, s'il y a une interaction génique telle que toute combinaison de gènes mutants UNE1 et B2 chez un individu entraîne l'inviabilité ou la stérilité, les hybrides (UNE0UNE1B0B2) entre les deux populations sera inviable ou stérile. Dans la figure 5A, nous avons supposé que le stock de fondation avait un génotype UNE0UNE0B0B0. Théoriquement, cependant, il est possible de supposer que le génotype ancestral est UNE1UNE1B1B1 et que ce génotype est resté inchangé dans la population 1, mais il a changé en UNE2UNE2B2B2 dans la population 2.

Modèle DM d'évolution de l'isolement reproductif. UNE0, UNE1, et UNE2 représentent des allèles au UNE lieu, alors que B0, B1, et B2 représentent des allèles au B lieu. (UNE) Modèle diploïde. (B) Modèle haploïde (gamète).

Modèle DM d'évolution de l'isolement reproductif. UNE0, UNE1, et UNE2 représentent des allèles au UNE lieu, alors que B0, B1, et B2 représentent des allèles au B lieu. (UNE) Modèle diploïde. (B) Modèle haploïde (gamète).

Orr (1996) a soutenu que la première personne qui a proposé le modèle DM n'est ni Dobzhansky ni Muller mais Bateson (1909) et que le modèle de Bateson était identique à celui de Dobzhansky et Muller. À notre avis, cet argument est contestable. Il est certainement vrai que Bateson a envisagé un modèle à deux locus de gènes complémentaires pour expliquer la stérilité hybride, mais il n'a jamais envisagé comment un tel système peut évoluer. En revanche, Dobzhansky et Muller ont expliqué le processus évolutif des gènes de stérilité hybrides, bien que très grossièrement. En biologie évolutive, il est important de comprendre le processus d'évolution. Pour cette raison, nous appellerons le modèle le modèle DM dans cet article. Cependant, Dobzhansky et Muller n'ont présenté qu'un argument verbal et n'ont jamais expliqué pourquoi seulement UNE1 est fixé dans la population 1 et B2 est fixé dans la population 2. Théoriquement, le B0B1 une mutation peut également se produire dans la population 1 et la UNE0UNE2 une mutation peut survenir dans la population 2 ( fig. 5A). Comment est alors seulement UNE1 fixé dans la population 1 et seulement B2 fixé dans la population 2 ? Dobzhansky et Muller ont tous deux soutenu que l'allèle UNE1 peut affecter un caractère secondaire par l'effet pléiotrope et cet effet peut conférer un avantage sélectif pour UNE1 plus de UNE0 dans la population 1. De même, B2 peut avoir un avantage sélectif sur B0 dans la population 2 en raison de l'effet pléiotrope.

La première étude mathématique de ce problème a été menée par Nei (1976). Présentons ici un résumé de ses résultats. Pour plus de simplicité, nous considérons le modèle haploïde donné sur la figure 5B au lieu du modèle diploïde car essentiellement le même résultat est obtenu par les deux modèles. Notez également que le modèle haploïde s'applique directement à la fertilité des spermatozoïdes ou des ovules. Dans le modèle haploïde, quatre génotypes possibles peuvent être générés pour les deux allèles à chacun des loci UNE et B, et nous attribuons les fitnesses pour les quatre génotypes comme indiqué dans le tableau 2. Ici, X et oui représentent les fréquences des allèles UNE1 et B2, respectivement, alors que sUNE et sB sont des avantages sélectifs conférés par la pléiotropie pour les allèles UNE1 et B2, respectivement, et t est le désavantage sélectif du génotype UNE1B2, qui devient 1 lorsque les hybrides interpopulations sont complètement stériles. Notez que les allèles UNE0, UNE1, B0, et B2 sont tous d'une importance vitale dans ce modèle. Ici, nous n'avons supposé aucun déséquilibre de liaison pour des raisons de simplicité.

Fitnesses et fréquences des quatre génotypes pour les deux loci d'incompatibilité dans le modèle haploïde

Fitnesses et fréquences des quatre génotypes pour les deux loci d'incompatibilité dans le modèle haploïde

Un problème ici est de savoir si les allèles UNE1 et B2 avoir un avantage sélectif (sUNE > 0 et sB > 0) conféré ou non par des effets pléiotropes. D'une manière générale, il est très difficile d'identifier un caractère affecté par les effets pléiotropes des gènes de spéciation UNE1 et B2, et même si un caractère est identifié, le coefficient de sélection sUNE et sB sont peu susceptibles de rester constants pendant tout le processus de fixation des allèles UNE1 et B2. Cependant, même si sUNE et sB sont 0, allèles UNE0 et B0 peut être remplacé par UNE1 et B2 dans les populations 1 et 2, respectivement, par l'effet de la dérive génétique. Dans ce cas aussi, seulement UNE1 ou B2 doit être fixé dans une population, et le temps de remplacement moyen sera de 1/v + 2N générations, où v et N sont le taux de mutation et la taille effective de la population ( Nei 1976). Par conséquent, il faudra beaucoup de temps pour les allèles UNE0 et B0 être remplacé par UNE1 et B2, respectivement. Même si UNE1 et B2 sont sélectionnés avec des valeurs positives de sUNE et sB, le temps de remplacement ne sera pas beaucoup plus court car il dépend principalement du taux de mutation ( Li et Nei 1977).

Il convient également de noter que le taux de mutation v se réfère uniquement aux mutations qui bénéficient d'un avantage sélectif en raison de l'effet pléiotrope au sein des populations mais génèrent de forts effets délétères lorsqu'elles sont réunies chez des individus hybrides. Personne n'a mesuré le taux de mutation pour ce type de mutations, mais le taux doit être très faible car seules des mutations spéciales seraient capables de produire de tels effets de double gène. Nous savons que le modèle DM est actuellement très populaire (e.g., Coyne et Orr 2004), mais il n'y a qu'un petit nombre de données expérimentales qui soutiennent le modèle au sens strict (tableau 1). L'article d'Orr (1995) est souvent cité comme la justification théorique du modèle. En réalité, il a assumé la validité du modèle dès le début et a simplement étudié la possibilité d'une accumulation continue de gènes d'incompatibilité. Il a conçu que l'isolement reproductif est développé par la sélection darwinienne positive causée par leurs effets pléiotropes. Ceci contraste avec le modèle Oka, où l'isolement reproductif est supposé se produire en raison de mutations délétères dans les gènes dupliqués.

Examinons maintenant quelques données expérimentales récentes qui ont été considérées comme supportant le modèle DM. Le premier ensemble de données que nous considérons est celui de l'article de Presgraves et al. (2003), dans lequel le changement évolutif d'une protéine de pore nucléaire (nucléoporine), Nup96, a été étudié en D. melanogaster et D. simulans. Les pores nucléaires sont de grands complexes protéiques qui traversent l'enveloppe nucléaire et permettent le transport de molécules hydrosolubles telles que les ARN, les ADN polymérases et les glucides entre le noyau et le cytoplasme. Ce pore nucléaire est composé d'une grande structure moléculaire appelée complexe de pores nucléaires, qui contient environ 30 composants protéiques différents, chacun avec plusieurs copies ( Presgraves et Stephan 2007). L'une des protéines est la nucléoporine Nup96, et Presgraves et al. (2003) ont montré que cette protéine est impliquée dans l'inviabilité mâle hybride entre les deux Drosophile espèce. Cette inviabilité hybride ne s'est produite que lorsque le D. simulans Nup96 gène est associé à la D. melanogaster chromosome X. Ils ont donc supposé que l'inviabilité hybride se produit lorsque le D. simulans Nup96 gène interagit négativement avec un ou plusieurs gènes du D. melanogaster chromosome X. De plus, le test de neutralité de McDonald et Kreitman (MK) (1991) suggère que le Nup96 gène évolué par sélection positive après divergence des deux espèces. Ils ont ensuite conclu que leurs observations soutiennent le modèle de spéciation DM et que l'inviabilité hybride est une conséquence de l'évolution adaptative au niveau du Nup96 lieu. Une étude similaire a été menée par Tang et Presgraves (2009), qui ont identifié un autre gène de la nucléoporine, Nup160, impliqué dans l'inviabilité mâle hybride entre les deux Drosophile espèce. Ce gène dans D. simulans a été déduit d'interagir négativement avec le D. melanogaster gènes du chromosome X ainsi qu'avec le D. simulans Nup96 gène.

Cependant, il y a quelques problèmes avec leurs conclusions. Premièrement, ils n'ont pas vraiment identifié les D. melanogaster Les gènes du chromosome X qui sont censés interagir avec le D. simulans Nup96 ou Nup160. Cette identification est critique car sinon nous ne savons pas comment l'interaction entre les deux gènes conduit à l'inviabilité des mâles hybrides. Théoriquement, les gènes du chromosome X peuvent ne pas être des gènes codant pour des protéines mais l'hétérochromatine qui est souvent impliquée dans l'inviabilité hybride (par exemple, Ferree et Barbash 2009, voir ci-dessous). Deuxièmement, Presgraves et ses collègues ont obtenu une signature de sélection positive pour l'augmentation de la fréquence des Nup96 et Nup160 en utilisant le test MK. Cependant, le test MK dépend d'un certain nombre d'hypothèses simplificatrices, et il peut donner des conclusions erronées lorsque ces hypothèses ne sont pas satisfaites (Nei et al. 2010).

Nous avons donc examiné l'étendue de la sélection positive en utilisant la méthode modifiée de Nei-Gojobori ( Zhang et al. 1998) de comparaison de séquences d'ADN. Dans cette méthode, le rapport du nombre de substitutions de nucléotides non synonymes par site (N) à celle des substitutions nucléotidiques synonymes (S) est calculé et l'étendue de la sélection positive est mesurée par N /S. Si N /S est supérieur à 1, une sélection positive est suggérée, alors que N /S < 1 indique une sélection négative ou purificatrice. De plus, cette analyse nous indique si les gènes de la nucléoporine évoluent plus rapidement que les autres gènes comme le prétendent souvent Presgraves et d'autres. Lorsque nous avons calculé ce rapport pour Nup96 et Nup160 en utilisant le D. melanogaster et D. simulans séquences, nous n'avons obtenu que 0,19 et 0,25, respectivement. Ces valeurs indiquent que les deux gènes n'ont pas évolué particulièrement vite parmi les 5 314 gènes examinés (0,16 en moyenne) et sont vraisemblablement sous sélection purificatrice ( fig. 6).

Distribution de N/S rapport entre le Drosophile melanogaster et D. simulans gènes. Un total de 5 314 gènes codant pour des protéines ayant des orthologues un à un parmi 12 Drosophile espèces ont été utilisées. Les N et S les valeurs ont été calculées par la méthode de Nei-Gojobori modifiée ( Zhang et al. 1998) avec un rapport transition/transversion de 2.

Distribution de N/S rapport entre le Drosophile melanogaster et D. simulans gènes. Un total de 5 314 gènes codant pour des protéines ayant des orthologues un à un parmi 12 Drosophile espèces ont été utilisées. Les N et S les valeurs ont été calculées par la méthode de Nei-Gojobori modifiée ( Zhang et al. 1998) avec un rapport transition/transversion de 2.

Cependant, ce qui est important ici n'est pas de savoir s'il y a eu sélection positive pour les nouveaux allèles mais de comprendre comment ces gènes génèrent l'inviabilité hybride. Certains peuvent soutenir que la sélection positive est importante car elle accélérerait le processus de spéciation. En réalité, aucun organisme n'a besoin d'avoir une spéciation rapide. L'isolement reproductif se produit simplement à la suite d'un changement évolutif plus général des caractères morphologiques ou physiologiques, et par conséquent, il doit s'agir d'un processus passif, comme l'a souligné Darwin (1859, p. 245).

Cependant, il existe quelques ensembles de données qui prennent apparemment en charge le modèle DM. Long et al. (2008) ont découvert qu'une paire de loci étroitement liés SaF et Sam dans le riz contiennent différents allèles dans les sous-espèces Japonica (SaF − et Sam − ) et Indica (SaF + et Sam + ), et les mâles de leurs hybrides sont stériles. Gène SaF code pour une protéine F-box impliquée dans la dégradation des protéines, alors que Sam produit une petite protéine de type ligase E3 modificateur de type ubiquitine. La protéine codée par SaF a une longueur de 476 acides aminés et il n'y a qu'une seule différence d'acides aminés entre les allèles SaF + et SaF - . Par contre, Sam + et Sam − codent pour des protéines à 257 acides aminés et 217 acides aminés, respectivement, cette dernière étant une protéine tronquée. Allèles SaF + et Sam + dans Indica sont considérés comme les gènes ancestraux, et SaF − et Sam − sont considérés comme des mutants générés au cours du processus d'évolution de Japonica (fig. 7). L'haplotype SaFSam + qui se trouve dans Indica pourrait être l'ancêtre de l'haplotype SaF − Sam - dans Japonica. Il s'hybride à la fois avec Indica et Japonica sans aucun problème ( fig. 7). Si tel est le cas, cet haplotype représente une étape intermédiaire dans le processus d'évolution de SaFSam - dans Japonica. Ces changements évolutifs de SaF + Sam + à SaF − SAM − sont compatibles avec le modèle DM. Cependant, la base moléculaire de l'interaction génique pour générer la stérilité hybride est encore inconnue.

Stérilité masculine causée par différentes combinaisons d'allèles au SaF et Sam loci dans le riz. Modifié de Long et al. (2008).

Stérilité masculine causée par différentes combinaisons d'allèles au SaF et Sam loci dans le riz. Modifié de Long et al. (2008).

Un autre ensemble de données qui prend en charge le modèle DM est celui de Chou et al. (2010), qui ont étudié une paire de gènes causant la F2 stérilité entre les levures S. cerevisiae et S. paradoxus. Les gènes étudiés sont le gène d'épissage de l'ARN mitochondrial codé dans le noyau (MRS1) et le gène de la cytochrome oxydase 1 codé par les mitochondries (COX1). Dans S. paradoxus, les introns de COX1 sont correctement épissés par ses propres MRS1. Dans S. cerevisiae, cependant, un (M1) des introns a été perdu de COX1. Cette mutation est probablement neutre car la perte d'intron n'a pas affecté la fonction du gène ou de la protéine de COX1. Par la suite, le MRS1 a perdu sa fonction d'épissage, qui semble également avoir été neutre. Cependant, les hybrides entre les deux espèces présentent une stérilité car la MRS1 protéines dans S. cerevisiae ne peut pas épisser l'intron M1 de COX1 de S. paradoxus. Ce schéma d'évolution de l'isolement reproductif est cohérent avec le modèle DM, et dans ce cas, il est probable que les changements évolutifs des gènes se soient produits principalement par mutation et dérive génétique. Un changement évolutif similaire a été rapporté pour expliquer la stérilité hybride causée par le AEP2 et OLI1 gènes entre S. cerevisiae et S. bayanus ( Lee et al. 2008, voir tableau 1).

De nombreux autres articles ont prétendu soutenir le modèle DM ( Coyne et Orr 2004 Wu et Ting 2004, voir tableau 1). Cependant, un examen attentif des articles indique que les auteurs ont souvent mal compris le concept du modèle ou que la démonstration est incomplète. Par conséquent, des études plus approfondies sont nécessaires sur les gènes rapportés dans ces articles (tableau 1). Notez que même lorsque certains gènes suivent complètement le modèle DM, ils n'ont peut-être rien à voir avec la spéciation, mais ils sont simplement devenus incompatibles simplement en tant que sous-produit de la divergence des espèces.

Modèle de gènes complémentaires multialléliques

Nei et al. (1983) ont proposé une version étendue du modèle DM pour expliquer la compatibilité génétique spécifique à l'espèce et d'autres isolements reproductifs. À titre d'exemple concret, considérons les changements évolutifs de la lysine, une protéine du sperme et de son récepteur d'ovule VERL chez les espèces d'ormeaux. Chez l'ormeau, les œufs sont entourés d'une enveloppe vitelline, et les spermatozoïdes doivent pénétrer dans cette enveloppe pour féconder l'œuf ( Shaw et al. 1995). Le récepteur VERL de la lysine est une longue glycoprotéine acide composée de 22 répétitions en tandem de 153 acides aminés et environ 40 molécules de lysine se lient à une molécule de VERL ( Galindo et al. 2003). L'interaction entre la lysine et VERL est spécifique à l'espèce et, par conséquent, cette paire de protéines contrôle apparemment l'accouplement spécifique à l'espèce. La figure 8 montre un modèle génétique expliquant la spécificité d'espèce entre les gènes lysine et VERL. Au sein d'une espèce (espèce 1 ou 2), les gènes lysine et VERL sont compatibles, de sorte que l'accouplement se déroule librement. Cependant, si les espèces 1 et 2 sont hybridées, la lysine et la VERL sont incompatibles, et donc la fécondation est bloquée. Cela garantit l'accouplement spécifique à l'espèce lorsque les deux espèces sont mélangées.

Un modèle de spécificité d'espèce de reconnaissance des gamètes entre la lysine et le VERL chez l'ormeau. Modifié de Nei et Zhang (1998).

Un modèle de spécificité d'espèce de reconnaissance des gamètes entre la lysine et le VERL chez l'ormeau. Modifié de Nei et Zhang (1998).

Cependant, il n'est pas très simple de produire le gène de l'espèce 2 à partir de celui de l'espèce 1 ou ceux des espèces 1 et 2 à partir de leurs gènes ancestraux communs par une seule mutation aux loci lysine et VERL car une mutation (UNEjeUNEk) au locus de la lysine rend le gène de la lysine incompatible avec l'allèle de type sauvage (Bje) au locus VERL. Une mutation (BjeBk) au locus VERL entraîne également l'incompatibilité avec l'allèle de type sauvage (UNEje) au locus de la lysine. Par conséquent, ces mutations n'augmenteraient pas en fréquence dans la population. Bien sûr, si les mutations UNEjeUNEk et BjeBk se produisent simultanément, la lysine UNEk et VERL Bk peut devenir compatible. Cependant, la chance que ces mutants se rencontrent dans une grande population serait très faible.

Pour cette raison, Nei et al. (1983) et Nei et Zhang (1998) ont proposé que le changement évolutif de l'allèle UNEje (ou Bje) à UNEk (ou Bk) se produit par le biais d'allèles intermédiaires et que les allèles étroitement apparentés ont des fonctions similaires et donc compatibles. Par exemple, UNEje peut muter d'abord en UNEj et ensuite à UNEk, tandis que Bje peut muter en Bj et ensuite à Bk. Supposer UNEje est compatible avec Bje et Bj mais pas avec Bk et Bje est compatible avec UNEje et UNEj mais pas avec UNEk. Si UNEj est compatible avec Bje, Bj, et Bk et si Bj est compatible avec UNEje, UNEj, et UNEk, il est alors possible de générer la combinaison spécifique à l'espèce d'allèles au niveau des loci lysine et VERL dans chaque espèce (je et k, respectivement) au moyen d'une mutation et d'une dérive génétique sans sélection positive qui est souvent supposée par le modèle DM.

Il existe plusieurs autres exemples d'incompatibilités entre les gènes ligands et récepteurs impliqués dans la fécondation ou la reproduction. Par exemple, la liaison à la protéine d'oursin médie la fécondation d'un spermatozoïde en un ovule. Le récepteur de la bindine est appelé EBR1 et son interaction avec la bindine est spécifique à l'espèce ( Kamei et Glabe 2003). Chez les mammifères, une protéine appelée ADAM2 (ou fertiline β) joue un rôle de ligand du sperme pour les récepteurs de la membrane plasmique de l'œuf, les intégrines (Evans et Florman 2002 Desiderio et al. 2010), et les interactions entre ces protéines semblent être spécifiques à l'espèce. L'interaction protéine-protéine dans divers processus biochimiques nécessaires au développement et à la physiologie est également souvent complémentaire. De même, le contrôle de l'expression des gènes codant pour les protéines par cis-les éléments réglementaires est complémentaire par nature.

Nei et al. (1983) ont développé plusieurs modèles d'évolution de l'isolement reproductif au moyen de gènes de complémentarité multialléliques. Ils ont considéré à la fois des modèles à un locus et à deux locus. On a supposé que la mutation se produisait selon le modèle par étapes ou le modèle à allèles infinis ( Kimura 1983), et la fitness d'un génotype était supposée être 1 ou 0 selon le modèle de mutation et le génotype généré ( fig. 9). Les isolements avant et après l'accouplement ont également été pris en compte. Leurs conclusions sont résumées de la manière suivante. 1) Le modèle à locus unique génère une spéciation plus rapidement que le modèle à deux locus. 2) Le modèle à allèles infinis génère une spéciation plus rapidement que le modèle de mutation par étapes. 3) Avec le modèle de gène épistatique utilisé ( fig. 9), l'évolution de l'isolement reproductif se produit plus rapidement dans les petites populations que dans les grandes populations. 4) De manière générale, le temps d'apparition de la spéciation est très long et est à peu près proportionnel à l'inverse du taux de mutation.

Modèle de mutation par étapes pour les gènes hybrides de stérilité (ou d'inviabilité). (UNE) Dans le modèle de mutation par étapes, la mutation vers l'avant et vers l'arrière peut se produire. (B) Les fertilités pour divers haplotypes pour les loci UNE et B (modèle à deux locus) et génotypes pour le locus UNE (modèle à un locus) sont donnés par 0 (infertile) ou 1 (fertile). Les haplotypes ou génotypes éloignés sont infertiles.

Modèle de mutation par étapes pour les gènes hybrides de stérilité (ou d'inviabilité). (UNE) Dans le modèle de mutation par étapes, la mutation vers l'avant et vers l'arrière peut se produire. (B) Les fertilités pour divers haplotypes pour les loci UNE et B (modèle à deux locus) et génotypes pour le locus UNE (modèle à un locus) sont donnés par 0 (infertile) ou 1 (fertile). Les haplotypes ou génotypes éloignés sont infertiles.

Cependant, ces résultats dépendent du modèle et nous ne pouvons pas appliquer les résultats aux populations naturelles sans qualification. Par exemple, le modèle à locus unique, qui sera examiné ci-dessous, peut ne s'appliquer qu'à certains caractères tels que le temps de floraison chez les plantes et le temps de développement chez les animaux. À l'heure actuelle, nous ne savons pas non plus lequel des modèles pas à pas et à allèles infinis est plus réaliste que l'autre, bien que nous pensons que ce dernier modèle est plus réaliste car l'isolement reproductif est contrôlé par un grand nombre de gènes contrôlant différents caractères phénotypiques. Nos résultats impliquent que la spéciation se produit plus rapidement à travers les goulots d'étranglement. Cette conclusion est en accord avec la théorie du principe fondateur de Mayr (1963), qui a été critiquée par de nombreux auteurs (par exemple, Coyne et Orr 2004). Cependant, l'étude de Nei et al. (1983) a été réalisée en utilisant des modèles mathématiques spécifiques d'interaction génique épistatique, contrairement à l'argument verbal de Mayr sans aucun modèle génétique. Cela signifierait également que les organismes autofécondants peuvent subir une évolution plus rapide que les populations d'accouplement aléatoires.

En général, cependant, la spéciation se produit très lentement, et il faut des millions à des dizaines de millions d'années pour que des espèces bien établies se développent ( Coyne et Orr 2004, pp. 419–421). Cela suggère que la conclusion de Nei et al. sur le temps de spéciation n'est peut-être pas si irréaliste.

Modèle de spéciation de mutation-sauvetage

Un exemple de gènes d'inviabilité hybride qui est souvent cité comme support du modèle DM est celui des gènes de formation de mélanome chez les espèces de poissons appartenant à Xiphophore (Orr et Presgraves 2000 Orr et al. 2004 Wu et Ting 2004). Les hybrides entre les espèces de ce genre produisent souvent un mélanome malin. Cette tumeur se développe lorsqu'un certain type d'expériences de croisement est menée, et l'une d'entre elles est présentée dans la figure 10. Dans cette figure, X + et X − représenter la présence et l'absence du gène tumorigène Xmrk, respectivement, alors que R + et R − désignent la présence et l'absence du gène régulateur (R), respectivement.

Des expériences de croisement typiques dans Xiphophore espèce. X + et X − représenter la présence et l'absence du Xmrk gène, respectivement. R + et R − représenter la présence et l'absence du R gène. F1 hybrides (X + X − , R + R − ) expriment un mélanome bénin, mais ils sont représentés avec celui de type normal sur cette figure. Un quart de la progéniture rétrocroisée développera un mélanome. Modifié de Schartl (2008).

Des expériences de croisement typiques dans Xiphophore espèce. X + et X − représenter la présence et l'absence du Xmrk gène, respectivement. R + et R − représenter la présence et l'absence du R gène. F1 hybrides (X + X − , R + R − ) expriment un mélanome bénin, mais ils sont représentés avec celui de type normal sur cette figure. Un quart de la progéniture rétrocroisée développera un mélanome. Modifié de Schartl (2008).

Gène Xmrk est une copie dupliquée d'un gène du récepteur du facteur de croissance épidermique et a acquis la capacité de générer un mélanome. Cependant, ce gène n'est exprimé que lorsque le gène suppresseur R est absent du génome. Par conséquent, les espèces avec des gènes Xmrk et R (X. maculatus En figue. 10) ne présente pas de mélanome. De même, les espèces sans Xmrk et R gènes (X. hellerje) est exempt de mélanome. Cependant, le génotype (X + XRR − ) avec un Xmrk gène mais non R gène dans la progéniture rétrocroisée développe le cancer du mélanome ( Schartl 2008). Si ce génotype présente une faible valeur adaptative, un isolement reproductif peut être développé.

Cependant, la base génétique de cette inviabilité hybride est très différente de celle du modèle DM. Notez que les génotypes (X + XR + R − ) et (XXR + R − ) sont normaux contrairement au cas du modèle DM. Dans le cas présent, le gène mutant Xmrk est intrinsèquement délétère ( fig. 10), mais au sein de chaque espèce, son effet délétère est diminué par la R gène. Cela signifie que Xmrk (X + ) est une mutation délétère et R + sauve l'effet délétère de la mutation et donc les individus porteurs de gènes X + et X + devenir normal. Nous appelons donc ce système d'incapacité hybride le modèle mutation-sauvetage. Notant que l'effet délétère du gène X + sur le fitness n'est pas de nature sérieuse, Schartl (2008) s'interroge sur la pertinence de ce système pour la spéciation. Cependant, nous aimerions utiliser ce système comme exemple du modèle de mutation-sauvetage avec l'anticipation que des exemples similaires seront probablement trouvés à l'avenir.

À l'heure actuelle, plusieurs ensembles de données peuvent être expliqués par le modèle de mutation-sauvetage, mais ils ne sont pas aussi simples que dans l'exemple ci-dessus. Chez les plantes, il existe de nombreux exemples de stérilité mâle cytoplasmique (CMS) (p. interagir avec les gènes nucléaires (interaction des gènes cytonucléaires). Fait intéressant, certains allèles mutants des gènes nucléaires peuvent sauver la fertilité masculine, bien que la base moléculaire de ce sauvetage ne soit pas bien comprise. Par exemple, dans le croisement de deux espèces de singes, Mimulus guttatus et M. nasutus, Case et Willis (2008) ont montré que le gène impliqué dans CMS est l'un des cadres de lecture ouverts qui sont cotranscrits avec le gène mitochondrial de la NADH déshydrogénase (NAD6), alors que Barr et Fishman (2010) ont montré que l'élément de sauvetage nucléaire est constitué de gènes appartenant à une très grande famille de gènes appelée la famille des pentatricopeptides répétés (PPR). Le nombre de copies de gènes de cette famille s'est énormément développé chez les plantes, et Arabidopsis possède ∼450 gènes PPR dispersés dans tout le génome ( Lurin et al. 2004). La fonction de cette famille de gènes n'est pas bien comprise, mais il a été prédit qu'environ la moitié des protéines PPR ciblent les mitochondries ( Chase 2007), et plusieurs auteurs ont signalé les gènes PPR comme des gènes de secours ( tableau 1). Cependant, comment cette grande famille de gènes interagit avec les éléments CMS pour réduire les effets délétères des mutations mitochondriales est un mystère. De plus, le processus évolutif des gènes mitochondriaux et nucléaires n'a pas été examiné dans ces études, de sorte qu'il n'est pas clair si ce système correspond vraiment au modèle de mutation-sauvetage. Évidemment, une étude plus approfondie est nécessaire. L'étude moléculaire de ce système semble même être à l'origine de l'étude du modèle du gène de distorsion de ségrégation, qui sera discuté ci-dessous.

Distorsions de ségrégation et spéciation

Chez les organismes diploïdes, un hétérozygote mâle (Aa) car un locus produit deux types différents de spermatozoïdes (UNE et une) avec une fréquence égale. Cependant, il existe des gènes qui faussent le rapport de ségrégation mendélienne en leur faveur de sorte que leur fréquence dans les spermatozoïdes est bien supérieure à 50 % (parfois près de 100 %). Ces gènes sont appelés distorsions de ségrégation (D- ). La distorsion de ségrégation se produit parce que le gène de distorsion détruit une forte proportion de chromosomes portant l'allèle opposé au cours du processus de spermatogenèse ( Hartl 1969 Wu et Hammer 1991 Kusano et al. 2003). Le gène de distorsion est souvent situé sur le chromosome X et, par conséquent, le sex-ratio dans la progéniture est faussé ( Presgraves 2008). Parce que ces mâles produisent plus de spermatozoïdes avec le chromosome X que de spermatozoïdes avec le Y, il y aura plus de descendants femelles que de descendants mâles, et ce sex-ratio déformé est désavantageux pour l'espèce. De plus, les gènes de distorsion eux-mêmes sont souvent délétères mais leurs fréquences peuvent augmenter considérablement par distorsion de ségrégation.

Fait intéressant, l'expression de D- gènes est souvent supprimé par des gènes suppresseurs (S - ). Par conséquent, si une nouvelle mutation de distorsion (D- ) survient dans une population, sa fréquence augmenterait initialement rapidement en raison de la distorsion de ségrégation malgré ses effets délétères. Cependant, cette augmentation de fréquence peut être stoppée si une nouvelle mutation suppressive (S - ) survient et supprime l'effet délétère de la D- gène. Les D- et S - les gènes peuvent alors être fixés simultanément dans une espèce. Après la fixation de ces mutations, il n'y aura aucune distorsion de ségrégation et aucun effet délétère de la D- ( Wu et al. 1988 Frank 1991 Lyttle 1991 Tao et al. 2001 Phadnis et Orr 2009).

Cependant, si cette nouvelle espèce aux gènes mutants D- et S - est croisé avec son espèce jumelle avec des allèles de type sauvage J+ et S + , l'effet de D- peut réapparaître dans le F1 hybrides si S - n'est pas dominant sur S + ou dans le F2 hybrides si D- est recombiné avec S + et génotypes D − D − S + S + ou D − D + S + S + sont produits ( Frank 1991 Hurst et Pomiankowski 1991 Tao et al. 2001). Si ces événements réduisent la fitness des individus hybrides, cela constituera un nouveau moyen de générer des barrières reproductives entre les deux espèces. La nature génétique des gènes suppresseurs n'est pas bien connue. Cependant, dans le cas de la Distorsion de ségrégation (D- ) haplotype signalé pour la première fois par Sandler et al. (1959) dans D. melanogaster, les S lieu (Répondeur) se compose d'un grand nombre de répétitions d'environ 120 pb, et il a été montré que la distorsion de ségrégation devient plus forte à mesure que le nombre de répétitions augmente et que lorsque le locus suppresseur contient un petit nombre de répétitions, aucune distorsion de ségrégation ne se produit ( Wu et al. 1988).

D- les gènes sont présents sur les chromosomes autosomiques ainsi que sur le Y, mais ils semblent être moins fréquents que ceux du chromosome X, comme l'ont discuté Frank (1991) et Jaenike (2001). Cette observation fournit une explication à la règle de Haldane (1922), qui stipule que lorsque deux espèces ou sous-espèces sont croisées, le sexe hétérogamétique avec les chromosomes XY ou ZW est plus souvent stérile ou inviable que le sexe homogamétique avec les chromosomes XX ou ZZ ( Frank 1991 Hurst et Pomiankowski 1991).

Des dizaines de gènes de distorsion ont été signalés chez les insectes, les mammifères et les plantes, bien que la base moléculaire de la distorsion ne soit pas bien comprise (Jaenike 2001). Dans D. simulans, au moins trois − des loci ont été identifiés et chaque S − le lieu correspond à chaque − locus ( Presgraves 2008). Dans ces cas, cependant, le mécanisme moléculaire de la fonction de S - loci n'est pas clair.

Incapacité hybride associée à l'hétérochromatine

Un certain nombre de chercheurs (par exemple, Henikoff et Malik 2002 Brideau et al. 2006 Bayes et Malik 2009) ont signalé que des éléments d'ADN répétés dans les régions d'hétérochromatine des génomes sont souvent associés à la stérilité ou à l'inviabilité des hybrides. Une des observations intéressantes est la stérilité hybride causée par le sauvetage hybride zygote (Zhr) lieu dans Drosophile. Lorsque D. simulans les femelles sont croisées avec D. melanogaster mâles, les femelles hybrides meurent au début de l'embryogenèse. Cependant, un allèle mutant (Zhr 1 ) de Zhr est connu pour sauver la viabilité des femelles ( Sawamura et al. 1993). Ferree et Barbash (2009) ont montré que l'allèle de type sauvage Zhr représente une région de 359 répétitions de nucléotides dans le D. melanogaster Chromosome X qui interagit avec certains facteurs cytoplasmiques de D. simulans. Le nombre de répétitions de 359 nucléotides est faible en D. simulans, de sorte que la fertilité au sein de cette espèce est élevée. Dans D. melanogaster, le nombre de répétitions d'ADN est élevé, mais cette espèce montre également une fertilité élevée apparemment parce que les facteurs cytoplasmiques sont différents de ceux de D. simulans. À l'heure actuelle, cependant, les éléments cytoplasmiques n'ont pas été identifiés et, par conséquent, la base moléculaire de l'interaction entre l'ADN et les facteurs cytoplasmiques reste incertaine. Pourtant, il semble que le nombre de répétitions d'ADN est spécifique à l'espèce et peut changer relativement rapidement en raison d'une évolution concertée ou de naissances et de morts ( Henikoff et Malik 2002). Bien que l'on sache peu de choses sur le mécanisme évolutif des éléments cytoplasmiques, il est possible que les éléments répétés de l'ADN et les facteurs cytoplasmiques coévoluent comme dans le cas du modèle de gènes complémentaires multialléliques à deux locus discuté précédemment.

Un autre exemple est l'homéobox Odysseus (OdsH), qui provoque la stérilité mâle hybride lorsque D. mauritiana les femelles sont croisées avec D. simulans mâles ( Ting et al. 1998 Sun et al. 2004). Dans ce cas, le récepteur de ce gène de facteur de transcription n'est pas bien défini. Récemment, cependant, Bayes et Malik (2009) ont découvert que le OdsH protéine produite à partir de D. mauritiana se localise sur le chromosome Y hétérochromatique de D. simulans mais le OdsH protéines de D. simulans ne fait pas. Ils ont alors proposé que la surexpression de la OdsH La protéine de l'hétérochromatine Y est responsable de la stérilité mâle. Encore une fois, cependant, le mécanisme moléculaire de l'interaction reste incertain. Un mécanisme similaire semble fonctionner avec le Prdm9 chez la souris ( Oliver et al. 2009, voir tableau 1).

Spéciation à un seul locus

Il est souvent affirmé que l'isolement reproductif ne peut pas être obtenu par des mutations à un seul locus car une mutation délétère se produisant à un locus ne peut être fixée dans aucune population. Cependant, si des mutations multialléliques se produisent à un locus et qu'elles sont compatibles les unes avec les autres lorsqu'elles sont étroitement apparentées, mais que les allèles mutants deviennent incompatibles lorsqu'ils sont éloignés de la parenté, la stérilité ou l'inviabilité hybride peut être générée à un seul locus. La figure 9 montre un tel exemple, où l'allèle UNE0 est compatible avec l'allèle UNE−1, UNE0, et UNE1 mais pas avec d'autres allèles (ignorer les allèles au locus B). Ainsi, le génotype UNE2UNE2 n'est pas compatible avec le génotype UNE0UNE0 dans la capacité d'accouplement ou la viabilité zygotique ou la stérilité. Les deux populations composées de UNE0UNE0 et UNE2UNE2 les individus seront alors isolés reproductivement.

Dans le riz, il existe un exemple qui soutient ce modèle au niveau moléculaire. La barrière reproductive entre Indica et Japonica est contrôlé par de nombreux gènes. L'un d'eux est le S5 gène qui code pour une protéase aspartique déterminant la fertilité du sac embryonnaire. La protéine codée par ce gène dans Indica (S5i) et Japonica (S5j) sont différents sur deux sites d'acides aminés ( Chen et al. 2008). L'une de ces différences (F273L) dans Japonica semble être responsable de la stérilité de l'hybride entre Indica et Japonica. Fait intéressant, cependant, il existe des souches qui produisent des hybrides fertiles à la fois avec Indica et Japonica. Les S5 gène (S5n) dans ces souches code pour une protéine avec une délétion d'un fragment de 115 acides aminés, et il pourrait s'agir d'un allèle intermédiaire entre S5i et S5j. Ce type de spéciation à un seul locus est plausible en particulier chez les organismes autofertiles comme le riz.

L'isolement reproductif par des loci uniques peut également se produire par des mutations contrôlant la période de floraison des plantes. Cela se produirait facilement dans les plantes autofertiles. Au niveau moléculaire, la période de floraison est contrôlée par un grand nombre de loci, dont beaucoup sont des gènes en double. Des facteurs environnementaux tels que la photopériodicité et la vernalisation affectent également la période de floraison. Ces dernières années, de nombreux gènes impliqués dans la régulation de la période de floraison ont été identifiés dans Arabidopsis ( Simpson et al. 1999 Boss et al. 2004 Pouteau et al. 2008). Bien que la période de floraison soit contrôlée par de nombreux gènes, une seule mutation peut modifier considérablement la période de floraison et peut produire un isolement reproductif. L'un des cas intéressants est une mutation survenue au locus de floraison (FLC), un répresseur de la floraison impliqué dans la voie de vernalisation. Les génomes de Brassica espèces contiennent plusieurs FLC gènes paralogues. Yuan et al. (2009) ont découvert que l'un des FLC gènes, FLC1 dans Brassica rapa, est polymorphe en ce qui concerne la période de floraison dans la nature, et ce polymorphisme est causé par la mutation du site d'épissage (G → A) dans l'intron 6. Il a ensuite été démontré que cette mutation modifiait la période de floraison. L'isolement reproductif dû à l'hétérogénéité du temps de développement se produit également chez les insectes ( Tauber CA et Tauber MJ 1977). Cependant, la base moléculaire de l'évolution de ce type d'isolement reproductif n'a pas été étudiée.

Autres mécanismes d'évolution de l'isolement reproductif

Il existe de nombreux autres modèles de spéciation basés sur un nombre relativement faible d'observations ou dont la base théorique n'est pas claire. Par exemple, la transposition de gènes peut également provoquer une incompatibilité hybride. Masly et al. (2006) ont montré que le JYAlpha gène codant pour la sous-unité alpha de l'adénosine triphosphatase Na + et K + a été transposé du chromosome 4 au chromosome 3R dans D. simulans après la divergence de D. melanogaster. Par conséquent, lorsque ces deux espèces sont croisées, certaines des F2 les individus n'ont pas de copie de JYAlpha dans le génome et deviennent stériles. Il s'agit d'un cas particulier de translocation réciproque classique de chromosomes évoqué plus haut. Cependant, la transposition ou la translocation de gènes peut se produire plus fréquemment que la translocation chromosomique, simplement parce qu'il y a plus de gènes que de chromosomes dans le génome et que les transposons peuvent intervenir dans le transfert de gènes. Plusieurs auteurs ( Henikoff et Malik 2002 Brown et O'Neill 2010) ont suggéré que l'évolution rapide et concertée des éléments répétés de l'ADN au niveau de la chromatine centromérique peut générer une spéciation en déformant la ségrégation chromosomique. La logique derrière cet argument n'est pas très claire, mais il est intéressant de noter que les éléments répétés sont souvent impliqués dans la stérilité et l'inviabilité hybrides. Il convient également de noter que les facteurs épigénétiques contrôlant la photopériodicité et la vernalisation chez les plantes sont apparemment impliqués dans la spéciation, bien que l'étude moléculaire de ces problèmes en soit encore à ses balbutiements.

Un autre modèle de spéciation proposé est la spéciation par antirecombinaison. Chez les levures, la machinerie de recombinaison vérifie l'identité des séquences d'ADN entre les chromosomes homologues. Si l'identité est faible, la machinerie supprime la recombinaison. Par conséquent, un hybride entre deux espèces de levure aurait un nombre réduit d'événements de recombinaison, ce qui provoque une non-disjonction chromosomique dans la méiose et l'aneuploïdie, ce qui entraîne à son tour une fertilité réduite de l'hybride (Hunter et al. 1996 Greig et al. 2003 Liti et al. 2006). Notez que dans ce mécanisme, la mutation joue apparemment un rôle important car ce mécanisme repose exclusivement sur la divergence des séquences génomiques entre deux populations, où aucune sélection naturelle n'est nécessaire.


Partie 1 : Explorer

  1. Entrez cette séquence de nucléotides d'ADN (évitez les espaces supplémentaires !) :
    ATGCTCTGTTTTATCTACGTCTCACCAACAGCCCATCAGAACAAGGATGAGTGGCGAAGCGGA
  2. Cliquez sur Transcrire et regardez la simulation.
  3. Cliquez sur Traduire et regardez la simulation.
  4. Examinez la protéine résultante.
    • Cliquez sur les acides aminés pour connaître leurs noms.
    • Prenez une capture d'écran de la protéine.
  5. Décrivez le processus de la simulation à un partenaire. Ce qui se produit?

Si des mutations surviennent au hasard sur toute la séquence du génome d'une espèce, comment un organe complexe comme un œil peut-il évoluer ? Comment toutes les mutations qui dirigent le développement de cet organe peuvent-elles être concentrées aux bons endroits ?

En revenant sur l'histoire du génome d'une espèce, les mutations semblent en effet attirées par certains emplacements génomiques (et également repoussées par d'autres). Mais les apparences peuvent être trompeuses, et la sélection est une grande illusionniste. Les mutations qui se produisent initialement au hasard peuvent finir par sembler être « dirigées » selon des schémas hautement non aléatoires, car la plupart des mutations qui se produisent sont rapidement perdues dans la population, souvent en une seule génération. Les relativement peu de mutations ne pas perdus sont ceux qui contribuent au changement évolutif.

Au sein d'une population, chaque mutation individuelle est extrêmement rare lorsqu'elle se produit pour la première fois, souvent il n'y en a qu'une seule copie dans le pool génétique d'une espèce entière. Mais un grand nombre de mutations peuvent se produire à chaque génération dans l'ensemble de l'espèce. Avec plus de six milliards d'individus, l'espèce humaine est maintenant si grande que chaque paire de bases des trois milliards du génome est mutée plusieurs fois, quelque part dans la population, à chaque génération. Certaines de ces mutations sont si nocives qu'elles sont éliminées avant même la naissance de leurs porteurs. Mais la grande majorité des mutations sont inoffensives (ou du moins tolérables), et très peu sont réellement utiles. Ceux-ci entrent dans la population en tant que versions alternatives extrêmement rares des gènes dans lesquels ils apparaissent.

La plupart des nouvelles mutations vont être perdues simplement parce qu'elles sont rares (même si elles sont bénéfiques), cependant, de très petits effets sur la survie et la reproduction peuvent grandement affecter les taux à long terme auxquels différentes mutations s'accumulent dans des gènes particuliers et à des sites particuliers au sein de gènes. Le résultat est un modèle de changement évolutif qui semble non aléatoire et en fait vraiment est non aléatoire : certains sites ne changent presque jamais, certains changent occasionnellement et d'autres changent relativement souvent.

Mais cela ne signifie pas que les mutations elles-mêmes se sont produites de manière non aléatoire. Rétrospectivement, c'est comme s'ils se produisaient là où c'était nécessaire. Mais en fait, ils se sont simplement accumulés là où c'était nécessaire, d'abord un, puis un autre, et un autre, sur de très nombreuses générations. Obtenir deux ou plusieurs mutations utiles ensemble dans le même génome peut prendre un certain temps, mais si elles ne sont pas perdues de la population, cela finira par se produire dans une espèce sexuelle.

Parfois, avec le recul, les biologistes peuvent déduire qu'un œil ou une autre adaptation complexe a été assemblé d'une manière particulière (par une séquence particulière de changements évolutifs). Cela conduit naturellement à penser que cette adaptation devait être assemblée de cette manière particulière, en suivant exactement cette séquence de mutations. Mais de nombreuses preuves et théories montrent que ce n'est presque jamais vrai.

Un organe sensible à la lumière rudimentaire et relativement inefficace peut être bien meilleur que rien du tout, et il peut y avoir des milliers de mutations différentes qui amélioreraient légèrement son fonctionnement de différentes manières. Lorsque l'un d'entre eux se produit et a la chance de ne pas être immédiatement perdu, puis augmente en fréquence au sein de la population, il prépare le terrain pour les autres. Mais il n'y a aucun moyen de prédire quelle mutation sera la prochaine à réussir.

Certaines adaptations humaines récentes avec des histoires génétiques connues illustrent bien ce principe. Par exemple, la capacité répandue mais non universelle de digérer le lactose du sucre du lait à l'âge adulte (tolérance au lactose) s'est récemment avérée provenir de l'une des nombreuses mutations différentes dans et à proximité du gène de la lactase. Ceux-ci se produisent dans des populations géographiquement isolées descendant des premiers pasteurs qui vivaient dans différentes parties de l'Afrique et de l'Eurasie. Dans ce cas comme dans d'autres, il semble y avoir eu beaucoup de hasard dans le processus qui a déterminé laquelle des nombreuses mutations possibles serait celle qui a fini par répondre à l'appel à un moment et à un endroit donnés.

Peut-être était-il prévisible que l'adaptation à une nouvelle ressource alimentaire (le lait de vaches et de chèvres domestiquées) se produirait, mais apparemment il n'était pas prévisible, même en principe, exactement comment cela se produirait.


Mutations adaptatives

Une autre question clé est de savoir si certaines mutations se produisent parce que l'organisme en a besoin. Y a-t-il une intention ou un but derrière la formation de mutations spécifiques ? Cette question a été soulevée à la suite de la découverte que certaines mutations n'apparaissent dans les bactéries que lorsque cela est nécessaire.8 Le problème est encore illustré par une étude qui a trouvé des mutations rares mais bénéfiques se produisant séquentiellement au sein de la même bactérie.9 Certains chercheurs tentent d'expliquer ces mutations dans un cadre classique. cadre néo-darwinien,10 mais même leurs propres calculs révèlent qu'il est hautement improbable que ces mutations se soient produites simplement dans le cadre d'un contexte mutationnel aléatoire.11 Au lieu de cela, aucun de ces exemples ne peut être facilement expliqué par des mutations se produisant au hasard.

Ce phénomène, appelé à l'origine mutations dirigées, est maintenant plus communément appelé mutations adaptatives (probablement pour réduire l'implication de mutations se produisant dans un but précis). Naturellement, le concept a été très controversé. Si certaines mutations surviennent en raison du besoin d'un organisme, plutôt que de se produire simplement au hasard, cela indique un programme directeur, tout le contraire du néo-darwinisme classique.

Pourtant, il existe de plus en plus de preuves que de nombreuses mutations ne sont pas aléatoires dans leur formation.12 En fait, de nombreuses mutations et autres altérations génétiques semblent être spécifiquement programmées. Cette programmation se produit à des phases précises de l'activité cellulaire ou en réponse à des signaux spécifiques de l'environnement.

Des études récentes ont montré que les réponses adaptatives chez les bactéries peuvent impliquer la même mutation survenant indépendamment dans différentes populations.13 De plus, des commutateurs de matrice courts (inversion de segments courts d'ADN) peuvent générer des modèles de mutation complexes dans les chromosomes humains.14 De plus, nous savons maintenant que certaines cellules immunitaires utilisent une voie mutationnelle hautement dirigée pour générer des anticorps uniques.15 Les cellules peuvent modifier leur état chromosomique et les schémas de méthylation de l'ADN en réponse à des signaux environnementaux.16 Et, au moins un groupe d'enzymes a été impliqué dans le contrôle à la fois de l'apparition et localisation des mutations chez l'homme.17


Des secrets révélés sur la façon dont les mutations de l'ADN causant des maladies se produisent

Une équipe de scientifiques de Penn State a mis en lumière les processus qui conduisent à certaines mutations de l'ADN humain qui sont impliquées dans des centaines de maladies héréditaires telles que la sclérose tubéreuse et la neurofibromatose de type 1. Les résultats pourraient un jour influencer la façon dont les couples qui cherchent à avoir des enfants bénéficier d'un conseil génétique.

L'équipe, dirigée par Kateryna Makova, professeure agrégée de biologie, comprend également Erika Kvikstad, étudiante diplômée au Département de biologie, et Francesca Chiaromonte, professeure agrégée de statistiques.

Les scientifiques ont examiné les insertions et les suppressions - des mutations dans lesquelles de petits fragments d'ADN sont ajoutés ou soustraits du génome - et ils ont trouvé des motifs dans les séquences d'ADN entourant immédiatement les mutations. "Les modèles dans les séquences d'ADN qui entourent les insertions et les suppressions suggèrent des mécanismes qui peuvent avoir généré les insertions et les suppressions", a déclaré Chiaromonte. Selon les chercheurs, l'étude est la première à détecter des modèles dans les séquences d'ADN adjacentes aux insertions et suppressions de fragments d'ADN à l'échelle du génome.

L'équipe a également trouvé des différences frappantes entre les insertions et les suppressions. Par exemple, ils ont découvert que les sites de reconnaissance de l'enzyme topoisomérase, qui est responsable de l'enroulement et du déroulement de l'ADN, étaient plus fréquents près des délétions que près des insertions. "Nous avons été surpris de constater que les modèles de séquences d'ADN entourant les insertions par rapport aux suppressions sont uniques car les scientifiques ont précédemment regroupé les deux types de mutations", a déclaré Kvikstad.

Les scientifiques pensaient également auparavant que les insertions et les suppressions étaient principalement dues à des erreurs se produisant lors de la réplication de l'ADN, mais l'équipe a découvert que les mutations peuvent également se former par des mécanismes liés à la recombinaison. "Ce qui est frappant, c'est que la plupart des insertions et des suppressions sont censées se produire par des erreurs de réplication et, bien qu'il s'agisse d'une source principale générant les mutations, nous avons découvert que la recombinaison est également très importante", a déclaré Kvikstad.

Pour l'une des premières fois dans une étude à l'échelle du génome, l'équipe a utilisé une méthode statistique, appelée analyse par ondelettes, qui permet aux scientifiques d'examiner la variabilité d'un échantillon à plusieurs échelles simultanément. Par exemple, les fichiers image JPEG, qui préservent les différentes qualités d'une image, que l'image soit plus petite ou plus grande, utilisent une méthode similaire à celle des ondelettes. Selon Chiaromonte, "Lorsque vous exécutez une analyse par ondelettes, vous caractérisez les signaux simultanément à plusieurs échelles. Dans notre cas, le signal était la composition des séquences d'ADN entourant les insertions et les suppressions. Pour pouvoir regarder ces séquences avec un multi -L'approche à grande échelle était vraiment importante pour notre capacité à trouver des fonctionnalités intéressantes."

À l'aide de l'analyse par ondelettes, l'équipe a confirmé que l'échelle est importante pour détecter les modèles de séquences d'ADN adjacentes aux insertions et aux suppressions. Par exemple, ils ont pu détecter un nombre accru de séquences d'ADN responsables de la pause de l'ADN polymérase, une enzyme impliquée dans la réplication de l'ADN, aux échelles les plus fines (10 à 20 paires de bases d'ADN), mais pas à des échelles plus grandes.

Les erreurs de réplication et de recombinaison peuvent entraîner des mutations pathogènes chez l'homme. Selon les chercheurs, si l'on sait que certaines maladies sont plus susceptibles d'être causées par des erreurs de recombinaison que par des erreurs de réplication, les médecins peuvent mieux conseiller les couples qui souhaitent avoir des enfants. "Par exemple, il existe une différence entre les hommes et les femmes dans le nombre de cycles de réplication que subissent leurs cellules germinales. Les mâles subissent plus de cycles de réplication d'ADN que les femelles et le nombre de cycles de réplication augmente avec l'âge d'un mâle. Si nous savons qu'un maladie est due à une erreur de réplication plutôt qu'à une erreur de recombinaison, les médecins peuvent fournir un meilleur conseil génétique aux couples », a déclaré Makova.

Ces résultats seront publiés dans le numéro de juillet 2009 de la revue Recherche sur le génome.

Cette recherche a reçu le soutien des National Institutes of Health et de la Penn State University.

Source de l'histoire :

Matériel fourni par État de Pennsylvanie. Remarque : Le contenu peut être modifié pour le style et la longueur.