Informations

Problème de RNase et EtOH

Problème de RNase et EtOH



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je travaille avec l'ARN et j'ai des problèmes de RNase. Par exemple, j'utilise le mini kit RNeasy et à une étape j'utilise 100% EtOH. Il ne dit pas qu'il est sans RNase ou non. L'EtOH absolu inhibe-t-il ou supprime-t-il la RNase ou dois-je m'en inquiéter ?

Ajout : j'utilise des eppendorfs directement à partir du sac. Donc, ils sont censés être sans RNase, n'est-ce pas ?

Merci.


L'éthanol n'est pas un problème, nous l'utilisons sans autre précaution et il semble être sans RNAse. Vous devez prendre les précautions habituelles que vous devez prendre avec tous les produits chimiques lorsque vous travaillez avec de l'ARN, n'utilisez jamais de spatule ou de cuillère pour sortir quoi que ce soit de la bouteille (sauf si vous voulez faire cuire vos spatules tout le temps), versez-les toujours pour éviter tout contamination.

Nous autoclavons l'Eppis une fois, cela pourrait être une précaution inutile. Je pense que vous pouvez également les acheter certifiés sans RNAse, mais je ne sais pas s'ils sont réellement traités différemment ou simplement plus chers.


Quel est le but de l'éthanol dans l'extraction d'ADN?

L'éthanol est utilisé dans l'extraction d'ADN pour forcer l'ADN à précipiter dans une solution. Afin de collecter un échantillon d'ADN, les cellules sont décomposées par agitation, puis mélangées avec de l'eau, du sel et de l'éthanol pour créer une solution aqueuse. L'éthanol et le sel agissent pour empêcher l'ADN de se dissoudre dans l'eau, le faisant plutôt précipiter afin qu'il puisse être séparé et extrait à l'aide d'une centrifugeuse.

Sans l'ajout d'éthanol ou d'un autre alcool comme l'isopropanol, l'ADN se dissoudra dans l'eau. En effet, les acides nucléiques (comme l'ADN) sont hydrophiles, ce qui signifie qu'ils se lient facilement aux molécules H2O. Le sel, qui est utilisé avec l'éthanol pour forcer l'ADN à précipiter, interagit avec les molécules d'ADN pour le rendre beaucoup moins hydrophile. L'éthanol facilite cette interaction.

L'ADN est hydrophile en raison des groupes phosphates chargés négativement trouvés le long de son squelette de phosphate de sucre. Ces groupes phosphates chargés négativement interagissent avec les atomes d'hydrogène chargés positivement dans les molécules d'eau. Le sel bloque ce processus. Lorsqu'il est dissous dans l'eau, l'un des produits du sel est Na+, un ion sodium chargé positivement. Ces ions sodium chargés positivement neutralisent la charge négative des groupes phosphate de l'ADN.

L'eau seule n'est pas suffisante pour permettre l'interaction entre les ions sodium et les groupes phosphate, car l'eau bloque l'attraction électrostatique entre les deux. L'éthanol permet à cette interaction de se produire, permettant aux ions sodium de protéger les groupes phosphate négatifs et provoquant la précipitation de l'ADN hors de la solution.


MATÉRIAUX ET MÉTHODES

Souches bactériennes et des conditions de croissance

Les souches utilisées dans cette étude sont répertoriées dans le tableau 1. S. aureus les souches ont été cultivées dans du milieu CYPG (10 g l -1 d'acides casaminés, 10 g l -1 d'extrait de levure, 5 g l -1 de NaCl, 0,5 % p/v de glucose et 0,06 M de phosphoglycérate) (31). Pour les souches porteuses de gènes de résistance, les antibiotiques ont été utilisés uniquement en culture d'une nuit aux concentrations suivantes : 10 g ml -1 d'érythromycine, 5 g ml -1 de tétracycline et 10 g ml -1 de chloramphénicol. Les bactéries des cultures d'une nuit ont été diluées à une densité optique initiale à 600 nm (DO600) de 0,05 dans un milieu frais et cultivées sous agitation à 220 tr/min à 37°C jusqu'à la phase de croissance exponentielle.

Souches bactériennes et plasmides

Souche ou plasmide. La description . Référence .
Souches
E. coli
TOP 10 Compétent E. coli pour la transformation des plasmides Invitrogène
DC10B Compétent E. coli pour la transformation directe de plasmides en isolats cliniques de S. aureus (46)
BL21 (DE3) E. coli pour l'expression de protéines recombinantes avec IPTG Promega
S. aureus
ISP479C Dérivé 8325-4, avec allèle SaeS L ( 47)
CYL316 RN4220(pYL112Δ19), L54 entier gène, ( 34)
RN4220 Déficient en restriction S. aureus souche ( 48)
RN4220-30 RN4220 saeP::kanACe travail
RN4220-217 RN4220 rny::ermC( 11)
Homme nouveau Type sauvage ( 49)
Newman-29 Homme nouveau, sae::kanA( 20)
Newman-30 Homme nouveau saeP::kanACette étude
Newman-217 Homme nouveau rny::ermC( 11)
Newman-217-30 Homme nouveau rny::ermC, saeP::kanACe travail
PR01 pyrFE mutant de la souche clinique SA564RD ( 39)
PR01-01 PR01 avec le gène RNase J1 supprimé ( 39)
Plasmides
Pour la construction de mutants SaeP
pMAD Vecteur de remplacement allélique ( 33)
pBT2 Vecteur de clonage ( 31)
pCWsae30 pMAD avec cloné saeP::kanACette étude
Pour le modèle PCR
pCWsae19 pCR2.1-Topo avec saePQRS avec codon stop dans saeP(T. Geiger, non publié)
Plasmides intégratifs
pCG188 pCL84 avec tronqué gfp cassette de gènes de pc183 ( 11)
pCG212 pCG188 avec sae région de P1 à l'amont de P3 ( 11)
pCG213 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de 13 pb dans le CS Ce travail
pCG218 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la tige-boucle gauche (terminateur) Ce travail
pCG219 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la tige-boucle droite Ce travail
pCG223 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de toute la région entre les deux boucles de tige Ce travail
pCG379 pCG188 avec sae région de P1 à l'amont de P3 avec délétion des deux boucles de tige Ce travail
pCG301 pCG188 avec sae région entre les 2 tiges-boucles sous le promoteur natif P1 Ce travail
pCG392 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la séquence en aval de CS (Rrs) Ce travail
pCG394 pCG188 avec sae région de P1 à l'amont de P3 avec délétion du CS et du CS alternatif (aCS) Ce travail
pCG484 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la contrepartie Rrs Ce travail
pCG589 pCG212 avec sae région avec CS muté (C au lieu de T) Ce travail
Plasmides réplicatifs
pCG246 E. coli/Vecteur navette Staphylococcus, dérivé de pCN47 avec chat cassette ( 50)
pCG599 pCG246 avec sae-gfp région du plasmide pCG212 Ce travail
pCG600 pCG246 avec sae-gfp région du plasmide pCG484 Ce travail
pCG601 pCG246 avec sae-gfp région du plasmide pCG392 Ce travail
pCG616 pCG246 avec sae-gfp région du plasmide pCG589 Ce travail
pCG618 pCG599 avec sae région avec mutation ponctuelle affectant la structure secondaire de Rrs : CC en +3 et +8 au lieu de AA, CC en +14 et +15 au lieu de TT (la position est indiquée comme distance au site de clivage) Ce travail
pCG620 pCG246 avec sae-gfp région du plasmide pCG223 Ce travail
Pour complémentation
pCG296 pCG246 avec rny pour complémentation ( 11)
pCG322 pCG246 avec rny sans site actif pour la complémentation Ce travail
pCG596 pCG246 avec rny porteur de mutations dans le site actif (H367A D368A) Ce travail
Pour la purification des protéines
pET15b Vecteur d'expression protéique, inductible par IPTG Novagen
pCG249 pET15b avec rny (sans domaine transmembranaire) Ce travail
Souche ou plasmide. La description . Référence .
Souches
E. coli
TOP 10 Compétent E. coli pour la transformation des plasmides Invitrogène
DC10B Compétent E. coli pour la transformation directe de plasmides en isolats cliniques de S. aureus (46)
BL21 (DE3) E. coli pour l'expression de protéines recombinantes avec IPTG Promega
S. aureus
ISP479C Dérivé 8325-4, avec allèle SaeS L ( 47)
CYL316 RN4220(pYL112Δ19), L54 entier gène, ( 34)
RN4220 Déficient en restriction S. aureus souche ( 48)
RN4220-30 RN4220 saeP::kanACe travail
RN4220-217 RN4220 rny::ermC( 11)
Homme nouveau Type sauvage ( 49)
Newman-29 Homme nouveau, sae::kanA( 20)
Newman-30 Homme nouveau saeP::kanACette étude
Newman-217 Homme nouveau rny::ermC( 11)
Newman-217-30 Homme nouveau rny::ermC, saeP::kanACe travail
PR01 pyrFE mutant de la souche clinique SA564RD ( 39)
PR01-01 PR01 avec le gène RNase J1 supprimé ( 39)
Plasmides
Pour la construction de mutants SaeP
pMAD Vecteur de remplacement allélique ( 33)
pBT2 Vecteur de clonage ( 31)
pCWsae30 pMAD avec cloné saeP::kanACette étude
Pour le modèle PCR
pCWsae19 pCR2.1-Topo avec saePQRS avec codon stop dans saeP(T. Geiger, non publié)
Plasmides intégratifs
pCG188 pCL84 avec tronqué gfp cassette de gènes de pc183 ( 11)
pCG212 pCG188 avec sae région de P1 à l'amont de P3 ( 11)
pCG213 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de 13 pb dans le CS Ce travail
pCG218 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la tige-boucle gauche (terminateur) Ce travail
pCG219 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la tige-boucle droite Ce travail
pCG223 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de toute la région entre les deux tiges-boucles Ce travail
pCG379 pCG188 avec sae région de P1 à l'amont de P3 avec délétion des deux boucles de tige Ce travail
pCG301 pCG188 avec sae région entre les 2 tiges-boucles sous le promoteur natif P1 Ce travail
pCG392 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la séquence en aval de CS (Rrs) Ce travail
pCG394 pCG188 avec sae région de P1 à l'amont de P3 avec délétion du CS et du CS alternatif (aCS) Ce travail
pCG484 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la contrepartie Rrs Ce travail
pCG589 pCG212 avec sae région avec CS muté (C au lieu de T) Ce travail
Plasmides réplicatifs
pCG246 E. coli/Vecteur navette Staphylococcus, dérivé de pCN47 avec chat cassette ( 50)
pCG599 pCG246 avec sae-gfp région du plasmide pCG212 Ce travail
pCG600 pCG246 avec sae-gfp région du plasmide pCG484 Ce travail
pCG601 pCG246 avec sae-gfp région du plasmide pCG392 Ce travail
pCG616 pCG246 avec sae-gfp région du plasmide pCG589 Ce travail
pCG618 pCG599 avec sae région avec mutation ponctuelle affectant la structure secondaire de Rrs : CC en +3 et +8 au lieu de AA, CC en +14 et +15 au lieu de TT (la position est indiquée comme distance au site de clivage) Ce travail
pCG620 pCG246 avec sae-gfp région du plasmide pCG223 Ce travail
Pour complémentation
pCG296 pCG246 avec rny pour complémentation ( 11)
pCG322 pCG246 avec rny sans site actif pour la complémentation Ce travail
pCG596 pCG246 avec rny porteur de mutations dans le site actif (H367A D368A) Ce travail
Pour la purification des protéines
pET15b Vecteur d'expression protéique, inductible par IPTG Novagen
pCG249 pET15b avec rny (sans domaine transmembranaire) Ce travail
Souche ou plasmide. La description . Référence .
Souches
E. coli
TOP 10 Compétent E. coli pour la transformation des plasmides Invitrogène
DC10B Compétent E. coli pour la transformation directe de plasmides en isolats cliniques de S. aureus (46)
BL21 (DE3) E. coli pour l'expression de protéines recombinantes avec IPTG Promega
S. aureus
ISP479C Dérivé 8325-4, avec allèle SaeS L ( 47)
CYL316 RN4220(pYL112Δ19), L54 entier gène, ( 34)
RN4220 Restriction-déficient S. aureus souche ( 48)
RN4220-30 RN4220 saeP::kanACe travail
RN4220-217 RN4220 rny::ermC( 11)
Homme nouveau Type sauvage ( 49)
Newman-29 Homme nouveau, sae::kanA( 20)
Newman-30 Homme nouveau saeP::kanACette étude
Newman-217 Homme nouveau rny::ermC( 11)
Newman-217-30 Homme nouveau rny::ermC, saeP::kanACe travail
PR01 pyrFE mutant de la souche clinique SA564RD ( 39)
PR01-01 PR01 avec le gène RNase J1 supprimé ( 39)
Plasmides
Pour la construction de mutants SaeP
pMAD Vecteur de remplacement allélique ( 33)
pBT2 Vecteur de clonage ( 31)
pCWsae30 pMAD avec cloné saeP::kanACette étude
Pour le modèle PCR
pCWsae19 pCR2.1-Topo avec saePQRS avec codon stop dans saeP(T. Geiger, non publié)
Plasmides intégratifs
pCG188 pCL84 avec tronqué gfp cassette de gènes de pc183 ( 11)
pCG212 pCG188 avec sae région de P1 à l'amont de P3 ( 11)
pCG213 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de 13 pb dans le CS Ce travail
pCG218 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la tige-boucle gauche (terminateur) Ce travail
pCG219 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la tige-boucle droite Ce travail
pCG223 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de toute la région entre les deux tiges-boucles Ce travail
pCG379 pCG188 avec sae région de P1 à l'amont de P3 avec délétion des deux boucles de tige Ce travail
pCG301 pCG188 avec sae région entre les 2 tiges-boucles sous le promoteur natif P1 Ce travail
pCG392 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la séquence en aval de CS (Rrs) Ce travail
pCG394 pCG188 avec sae région de P1 à l'amont de P3 avec délétion du CS et du CS alternatif (aCS) Ce travail
pCG484 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la contrepartie Rrs Ce travail
pCG589 pCG212 avec sae région avec CS muté (C au lieu de T) Ce travail
Plasmides réplicatifs
pCG246 E. coli/Vecteur navette Staphylococcus, dérivé de pCN47 avec chat cassette ( 50)
pCG599 pCG246 avec sae-gfp région du plasmide pCG212 Ce travail
pCG600 pCG246 avec sae-gfp région du plasmide pCG484 Ce travail
pCG601 pCG246 avec sae-gfp région du plasmide pCG392 Ce travail
pCG616 pCG246 avec sae-gfp région du plasmide pCG589 Ce travail
pCG618 pCG599 avec sae région avec mutation ponctuelle affectant la structure secondaire de Rrs : CC en +3 et +8 au lieu de AA, CC en +14 et +15 au lieu de TT (la position est indiquée comme distance au site de clivage) Ce travail
pCG620 pCG246 avec sae-gfp région du plasmide pCG223 Ce travail
Pour complémentation
pCG296 pCG246 avec rny pour complémentation ( 11)
pCG322 pCG246 avec rny sans site actif pour la complémentation Ce travail
pCG596 pCG246 avec rny porteur de mutations dans le site actif (H367A D368A) Ce travail
Pour la purification des protéines
pET15b Vecteur d'expression protéique, inductible par IPTG Novagen
pCG249 pET15b avec rny (sans domaine transmembranaire) Ce travail
Souche ou plasmide. La description . Référence .
Souches
E. coli
TOP 10 Compétent E. coli pour la transformation des plasmides Invitrogène
DC10B Compétent E. coli pour la transformation directe de plasmides en isolats cliniques de S. aureus (46)
BL21 (DE3) E. coli pour l'expression de protéines recombinantes avec IPTG Promega
S. aureus
ISP479C Dérivé 8325-4, avec allèle SaeS L ( 47)
CYL316 RN4220(pYL112Δ19), L54 entier gène, ( 34)
RN4220 Restriction-déficient S. aureus souche ( 48)
RN4220-30 RN4220 saeP::kanACe travail
RN4220-217 RN4220 rny::ermC( 11)
Homme nouveau Type sauvage ( 49)
Newman-29 Homme nouveau, sae::kanA( 20)
Newman-30 Homme nouveau saeP::kanACette étude
Newman-217 Homme nouveau rny::ermC( 11)
Newman-217-30 Homme nouveau rny::ermC, saeP::kanACe travail
PR01 pyrFE mutant de la souche clinique SA564RD ( 39)
PR01-01 PR01 avec le gène RNase J1 supprimé ( 39)
Plasmides
Pour la construction de mutants SaeP
pMAD Vecteur de remplacement allélique ( 33)
pBT2 Vecteur de clonage ( 31)
pCWsae30 pMAD avec cloné saeP::kanACette étude
Pour le modèle PCR
pCWsae19 pCR2.1-Topo avec saePQRS avec codon stop dans saeP(T. Geiger, non publié)
Plasmides intégratifs
pCG188 pCL84 avec tronqué gfp cassette de gènes de pc183 ( 11)
pCG212 pCG188 avec sae région de P1 à l'amont de P3 ( 11)
pCG213 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de 13 pb dans le CS Ce travail
pCG218 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la tige-boucle gauche (terminateur) Ce travail
pCG219 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la tige-boucle droite Ce travail
pCG223 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de toute la région entre les deux boucles de tige Ce travail
pCG379 pCG188 avec sae région de P1 à l'amont de P3 avec délétion des deux boucles de tige Ce travail
pCG301 pCG188 avec sae région entre les 2 tiges-boucles sous le promoteur natif P1 Ce travail
pCG392 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la séquence en aval de CS (Rrs) Ce travail
pCG394 pCG188 avec sae région de P1 à l'amont de P3 avec délétion du CS et du CS alternatif (aCS) Ce travail
pCG484 pCG188 avec sae région de P1 à l'amont de P3 avec délétion de la contrepartie Rrs Ce travail
pCG589 pCG212 avec sae région avec CS muté (C au lieu de T) Ce travail
Plasmides réplicatifs
pCG246 E. coli/Vecteur navette Staphylococcus, dérivé de pCN47 avec chat cassette ( 50)
pCG599 pCG246 avec sae-gfp région du plasmide pCG212 Ce travail
pCG600 pCG246 avec sae-gfp région du plasmide pCG484 Ce travail
pCG601 pCG246 avec sae-gfp région du plasmide pCG392 Ce travail
pCG616 pCG246 avec sae-gfp région du plasmide pCG589 Ce travail
pCG618 pCG599 avec sae région avec mutation ponctuelle affectant la structure secondaire de Rrs : CC en +3 et +8 au lieu de AA, CC en +14 et +15 au lieu de TT (la position est indiquée comme distance au site de clivage) Ce travail
pCG620 pCG246 avec sae-gfp région du plasmide pCG223 Ce travail
Pour complémentation
pCG296 pCG246 avec rny pour complémentation ( 11)
pCG322 pCG246 avec rny sans site actif pour la complémentation Ce travail
pCG596 pCG246 avec rny porteur de mutations dans le site actif (H367A D368A) Ce travail
Pour la purification des protéines
pET15b Vecteur d'expression protéique, inductible par IPTG Novagen
pCG249 pET15b avec rny (sans domaine transmembranaire) Ce travail

Construction de plasmide et de contrainte

Tous les plasmides et oligonucléotides sont répertoriés dans les tableaux 1 et 2, respectivement.

Oligonucléotides

But . Modèle . Nom . Séquence.
saeP mutant de délétion
ISP479C Kpnsae-pour CGGGGTACCATACTACAGTTTTACATT
Kpn-ORF4-rev ACCTCGGTACCCTGTTCTTACGACCTCTAAAG
HybridORF4a-rechts TAAAAGTTCGCTAGATAGGGGTCCCGCCGTATGATTTCACAGCC
Liens hybrides TCCAATTCTCGTTTTCATACCTCGGAGCTAACTCCTCATTTCTTCAATTT
Newman29 kanR-pour CCGAGGTATGAAAACGAGAATTGG
kanR-rev GGGACCCCTATCTAGCGAACTTT
sae–gfp fusion dans un plasmide intégratif (pCG188)
Eco-sae-pour GCGTGAATTCTTATTGTGGCAAAAGGTTT
Eco-sae1283rev CGTGAATTCTGACGTCGTATTGTGCAACTA
Eco-sae1014rev GGGAATTCTTATGTGAACAGGAAGTGTTT
contrôler les PCR gfp-rev-all GGTATCACCTTCAAACTTGACTT
pCG213 pcwsae19 DelP2for TCAATATATATACCATAAGATTGC
DelP2rev GCAATCTTATGGTATATATATTGA
pCG218 pcwsae19 DelST-orf4for AGAGCACATAAGAAACACTTCCT
DelST-orf4rev AGGAAGTGTTTCTTATGTGCTCT
pCG219 pcwsae19 DelST5pour TCAATGGAAAGCATATATACAACT
DelST5rev AGTTGTATATATGCTTTCCATTGA
pCG223 pcwsae19 DelP2longfor TCAATGGAAAGCAAACACTTCCT
DelP2longrev AGGAAGTGTTTGCTTTCCATTGA
pCG379 pCG218 DelST5rev AGTTGTATATATGCTTTCCATTGA
DelST5pour TCAATGGAAAGCATATATACAACT
pCG301 pcwsae19 hybridesaePdelrev CTTTCCATTGAGTAACCTTGATCTTGTGA
hybridesaePdelfor CACAAGATCAAGGTTACTCAATGGAAAGC
pCG392 pcwsae19 hybridepCG392rev TCAAGCTCTAAAAAAATTTAGATTTAATAGTTGTATATAT
hybridepCG392pour ATATATACAACTATTAAATCTAAATTTTTTTAGAGCTTGAT
pCG394 pcwsae19 hybridepCG394rev TGTGCTCTGCAATCTTATGGATTGAAAAAAGGAAAGTATG
hybridepCG394pour CATACTTTCCTTTTTTCAATCCATAAGATTGCAGAGCACA
pCG484 pcwsae19 Hybrid-Rrs-Counter-rev CGATTTGTAGTGTTATGTGA
Hybride-Rrs-Compteur-pour TCACATAACACTACAAATCGTTTATATAAATTACACACAAT
pCG589 pCG212 Q5SDMpCG212R ATATATTGAAAAAAGGAAAAGTATGATTTC
Q5SDMpCG212F ATACAACTATCAAATCCCATAAGATTG
sae–gfp fusion dans un plasmide réplicatif (pCG246)
pCG599 pCG212 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG600 pCG484 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG601 pCG392 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG616 pCG589 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG618 pCG599 Q5SDMpCG618F AAGACCGCAGAGCACATAAGTAAATTTTTTTAG
Q5SDMpCG618R AGGGGAGTTAATAGTTGTATATATATTGAAAAAAAGG
pCG620 pCG223 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
Complément RNase Y
pCG322 RN6390 RecA-dig-for GTCAAGGTAAGGAAAATGTT
hybride-Rny-delKD-rev TGCACCTGGACGAGCTACATTTTGACCGT
hybride-Rny-delKD-pour ACGGTCAAAATGTAGCTCGTCCAGGTGCA
SAV1287-rév AACAATTTGTTGCAATTG
BamHI-RNY-pour CCGGATCCGTTAAACTTAGCAAATATCCT
EcoRI-RNY-rev CGAATTCCTCAACTTAGAAATAAATCCTA
pCG596 pCG296 Q5SDMpCG296R GCTCGTTTCGCTAATGTC
Q5SDMpCG296F TGGACTTTTAGCTGCTGTTGGTAAAGCAATTGATC
Course
Adaptateur ARN 5΄ CTAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATA
gfp-rev1 TCTTTTGTTTGTCTGCCAT
Course 2 Course 2 GTATTGCGGTACCCTTGT
gfp-rev-all GGTATCACCTTCAAACTTGACTT
Sondes DIG
gfppCG188 gfp-creuser-pour CACTTGTCACTACTTTCGGTT
gfp-dig-rev TCTCTCTTTTCGTTGGGAT
saePRN6390 uorf4358 TATTATTTGCCTTCATTTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
rnyRN6390 SAV1286dig-pour TTATTAGAGAAGCAGGTGAACA
SAV1286dig-rev TCTTCAGGAGATACAATCACTC
rny 5 premierRN6390 RNY-creuser-pour2 TTCATATAAAGAGCAAACCC
RNY-dig-rev2 TTTTGATATTGTCAGCTTCT
rnjARN6390 sav1089digfor CACCGATACCACTACCAT
sav1089digrev ACCTGAAGATACCGTTTGT
RT-qPCR
norme saeRHomme nouveau T7sae TAATACGACTCACTATAGGGAGAAACTGCCAAAAACACAAGA
saeR2 CCATTATCGGCTCCTTTCA
norme saePHomme nouveau T7-ORF4 TAATACGACTCACTATAGGGAGACAAATTGAAGAAATGAGGAGGTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
saeR saeR4 TAGTCATATCCCCAAACTT
saeU4 CCATTTACGCCTTAACTTTA
saeP uorf4358 TATTATTTGCCTTCATTTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
Purification des protéines
pCG249 Homme nouveau Xho-rny-pETfor GGGGCTCGAGCGAAATTTGTTGCTTCAAAAG
Bam-rny-pETrev GGGGGGATCCTTATTTCGCATATTCTACTGCT
Transcriptions pour la RNase Y in vitro essai de clivage
pCG212 et pCG484 T7saeorf4u TAATACGACTCACTATAGGGAGACAAATTGAAGAAATGAGGAGGTTA
LCgfpmut3.1rev1 TCTTTTGTTTGTCTGCCAT
But . Modèle . Nom . Séquence.
saeP mutant de délétion
ISP479C Kpnsae-pour CGGGGTACCATACTACAGTTTTACATT
Kpn-ORF4-rev ACCTCGGTACCCTGTTCTTACGACCTCTAAAG
HybridORF4a-rechts TAAAAGTTCGCTAGATAGGGGTCCCGCCGTATGATTTCACAGCC
Liens hybrides TCCAATTCTCGTTTTCATACCTCGGAGCTAACTCCTCATTTCTTCAATTT
Newman29 kanR-pour CCGAGGTATGAAAAACGAGAATTGG
kanR-rev GGGACCCCTATCTAGCGAACTTT
sae–gfp fusion dans un plasmide intégratif (pCG188)
Eco-sae-pour GCGTGAATTCTTATTGTGGCAAAAGGTTT
Eco-sae1283rev CGTGAATTCTGACGTCGTATTGTGCAACTA
Eco-sae1014rev GGGAATTCTTATGTGAACAGGAAGTGTTT
contrôler les PCR gfp-rev-all GGTATCACCTTCAAACTTGACTT
pCG213 pcwsae19 DelP2for TCAATATATATACCATAAGATTGC
DelP2rev GCAATCTTATGGTATATATATTGA
pCG218 pcwsae19 DelST-orf4for AGAGCACATAAGAAACACTTCCT
DelST-orf4rev AGGAAGTGTTTCTTATGTGCTCT
pCG219 pcwsae19 DelST5pour TCAATGGAAAGCATATATACAACT
DelST5rev AGTTGTATATATGCTTTCCATTGA
pCG223 pcwsae19 DelP2longfor TCAATGGAAAGCAAACACTTCCT
DelP2longrev AGGAAGTGTTTGCTTTCCATTGA
pCG379 pCG218 DelST5rev AGTTGTATATATGCTTTCCATTGA
DelST5pour TCAATGGAAAGCATATATACAACT
pCG301 pcwsae19 hybridesaePdelrev CTTTCCATTGAGTAACCTTGATCTTGTGA
hybridesaePdelfor CACAAGATCAAGGTTACTCAATGGAAAGC
pCG392 pcwsae19 hybridepCG392rev TCAAGCTCTAAAAAAATTTAGATTTAATAGTTGTATATAT
hybridepCG392pour ATATATACAACTATTAAATCTAAATTTTTTTAGAGCTTGAT
pCG394 pcwsae19 hybridepCG394rev TGTGCTCTGCAATCTTATGGATTGAAAAAAGGAAAGTATG
hybridepCG394pour CATACTTTCCTTTTTTCAATCCATAAGATTGCAGAGCACA
pCG484 pcwsae19 Hybrid-Rrs-Counter-rev CGATTTGTAGTGTTATGTGA
Hybride-Rrs-Compteur-pour TCACATAACACTACAAATCGTTTATATAAATTACACACAAT
pCG589 pCG212 Q5SDMpCG212R ATATATTGAAAAAAGGAAAAGTATGATTTC
Q5SDMpCG212F ATACAACTATCAAATCCCATAAGATTG
sae–gfp fusion dans un plasmide réplicatif (pCG246)
pCG599 pCG212 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG600 pCG484 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG601 pCG392 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG616 pCG589 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG618 pCG599 Q5SDMpCG618F AAGACCGCAGAGCACATAAGTAAATTTTTTTAG
Q5SDMpCG618R AGGGGAGTTAATAGTTGTATATATATTGAAAAAAAGG
pCG620 pCG223 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
Complément RNase Y
pCG322 RN6390 RecA-dig-for GTCAAGGTAAGGAAAATGTT
hybride-Rny-delKD-rev TGCACCTGGACGAGCTACATTTTGACCGT
hybride-Rny-delKD-pour ACGGTCAAAATGTAGCTCGTCCAGGTGCA
SAV1287-rév AACAATTTGTTGCAATTG
BamHI-RNY-pour CCGGATCCGTTAAACTTAGCAAATATCCT
EcoRI-RNY-rev CGAATTCCTCAACTTAGAAATAAATCCTA
pCG596 pCG296 Q5SDMpCG296R GCTCGTTTCGCTAATGTC
Q5SDMpCG296F TGGACTTTTAGCTGCTGTTGGTAAAGCAATTGATC
Course
Adaptateur ARN 5΄ CTAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATA
gfp-rev1 TCTTTTGTTTGTCTGCCAT
Course 2 Course 2 GTATTGCGGTACCCTTGT
gfp-rev-all GGTATCACCTTCAAACTTGACTT
Sondes DIG
gfppCG188 gfp-creuser-pour CACTTGTCACTACTTTCGGTT
gfp-dig-rev TCTCTCTTTTCGTTGGGAT
saePRN6390 uorf4358 TATTATTTGCCTTCATTTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
rnyRN6390 SAV1286dig-pour TATTAGAGAAGCAGGTGAACA
SAV1286dig-rev TCTTCAGGAGATACAATCACTC
rny 5 premierRN6390 RNY-creuser-pour2 TTCATATAAAGAGCAAACCC
RNY-dig-rev2 TTTTGATATTGTCAGCTTCT
rnjARN6390 sav1089digfor CACCGATACCACTACCAT
sav1089digrev ACCTGAAGATACCGTTTGT
RT-qPCR
norme saeRHomme nouveau T7sae TAATACGACTCACTATAGGGAGAAACTGCCAAAAACACAAGA
saeR2 CCATTATCGGCTCCTTTCA
norme saePHomme nouveau T7-ORF4 TAATACGACTCACTATAGGGAGACAAATTGAAGAAATGAGGAGGTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
saeR saeR4 TAGTCATATCCCCAAACTT
saeU4 CCATTTACGCCTTAACTTTA
saeP uorf4358 TATTATTTGCCTTCATTTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
Purification des protéines
pCG249 Homme nouveau Xho-rny-pETfor GGGGCTCGAGCGAAATTTGTTGCTTCAAAAG
Bam-rny-pETrev GGGGGGATCCTTATTTCGCATATTCTACTGCT
Transcriptions pour la RNase Y in vitro essai de clivage
pCG212 et pCG484 T7saeorf4u TAATACGACTCACTATAGGGAGACAAATTGAAGAAATGAGGAGGTTA
LCgfpmut3.1rev1 TCTTTTGTTTGTCTGCCAT
But . Modèle . Nom . Séquence.
saeP mutant de délétion
ISP479C Kpnsae-pour CGGGGTACCATACTACAGTTTTACATT
Kpn-ORF4-rev ACCTCGGTACCCTGTTCTTACGACCTCTAAAG
HybridORF4a-rechts TAAAAGTTCGCTAGATAGGGGTCCCGCCGTATGATTTCACAGCC
Liens hybrides TCCAATTCTCGTTTTCATACCTCGGAGCTAACTCCTCATTTCTTCAATTT
Newman29 kanR-pour CCGAGGTATGAAAACGAGAATTGG
kanR-rev GGGACCCCTATCTAGCGAACTTT
sae–gfp fusion dans un plasmide intégratif (pCG188)
Eco-sae-pour GCGTGAATTCTTATTGTGGCAAAAGGTTT
Eco-sae1283rev CGTGAATTCTGACGTCGTATTGTGCAACTA
Eco-sae1014rev GGGAATTCTTATGTGAACAAGGAAGGTGTTT
contrôler les PCR gfp-rev-all GGTATCACCTTCAAACTTGACTT
pCG213 pcwsae19 DelP2for TCAATATATATACCATAAGATTGC
DelP2rev GCAATCTTATGGTATATATATTGA
pCG218 pcwsae19 DelST-orf4for AGAGCACATAAGAAACACTTCCT
DelST-orf4rev AGGAAGTGTTTCTTATGTGCTCT
pCG219 pcwsae19 DelST5pour TCAATGGAAAGCATATATACAACT
DelST5rev AGTTGTATATATGCTTTCCATTGA
pCG223 pcwsae19 DelP2longfor TCAATGGAAAGCAAACACTTCCT
DelP2longrev AGGAAGTGTTTGCTTTCCATTGA
pCG379 pCG218 DelST5rev AGTTGTATATATGCTTTCCATTGA
DelST5pour TCAATGGAAAGCATATATACAACT
pCG301 pcwsae19 hybridesaePdelrev CTTTCCATTGAGTAACCTTGATCTTGTGA
hybridesaePdelfor CACAAGATCAAGGTTACTCAATGGAAAGC
pCG392 pcwsae19 hybridepCG392rev TCAAGCTCTAAAAAAATTTAGATTTAATAGTTGTATATAT
hybridepCG392pour ATATATACAACTATTAAATCTAAATTTTTTTAGAGCTTGAT
pCG394 pcwsae19 hybridepCG394rev TGTGCTCTGCAATCTTATGGATTGAAAAAAGGAAAGTATG
hybridepCG394pour CATACTTTCCTTTTTTCAATCCATAAGATTGCAGAGCACA
pCG484 pcwsae19 Hybrid-Rrs-Counter-rev CGATTTGTAGTGTTATGTGA
Hybride-Rrs-Compteur-pour TCACATAACACTACAAATCGTTTATATAAATTACACACAAT
pCG589 pCG212 Q5SDMpCG212R ATATATTGAAAAAAGGAAAAGTATGATTTC
Q5SDMpCG212F ATACAACTATCAAATCCCATAAGATTG
sae–gfp fusion dans un plasmide réplicatif (pCG246)
pCG599 pCG212 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG600 pCG484 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG601 pCG392 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG616 pCG589 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG618 pCG599 Q5SDMpCG618F AAGACCGCAGAGCACATAAGTAAATTTTTTTAG
Q5SDMpCG618R AGGGGAGTTAATAGTTGTATATATATTGAAAAAAAGG
pCG620 pCG223 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
Complément RNase Y
pCG322 RN6390 RecA-dig-for GTCAAGGTAAGGAAAATGTT
hybride-Rny-delKD-rev TGCACCTGGACGAGCTACATTTTGACCGT
hybride-Rny-delKD-pour ACGGTCAAAATGTAGCTCGTCCAGGTGCA
SAV1287-rév AACAATTTGTTGCAATTG
BamHI-RNY-pour CCGGATCCGTTAAACTTAGCAAATATCCT
EcoRI-RNY-rev CGAATTCCTCAACTTAGAAATAAATCCTA
pCG596 pCG296 Q5SDMpCG296R GCTCGTTTCGCTAATGTC
Q5SDMpCG296F TGGACTTTTAGCTGCTGTTGGTAAAGCAATTGATC
Course
Adaptateur ARN 5΄ CTAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATA
gfp-rev1 TCTTTTGTTTGTCTGCCAT
Course 2 Course 2 GTATTGCGGTACCCTTGT
gfp-rev-all GGTATCACCTTCAAACTTGACTT
Sondes DIG
gfppCG188 gfp-creuser-pour CACTTGTCACTACTTTCGGTT
gfp-dig-rev TCTCTCTTTTCGTTGGGAT
saePRN6390 uorf4358 TATTATTTGCCTTCATTTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
rnyRN6390 SAV1286dig-pour TATTAGAGAAGCAGGTGAACA
SAV1286dig-rev TCTTCAGGAGATACAATCACTC
rny 5 premierRN6390 RNY-creuser-pour2 TTCATATAAAGAGCAAACCC
RNY-dig-rev2 TTTTGATATTGTCAGCTTCT
rnjARN6390 sav1089digfor CACCGATACCACTACCAT
sav1089digrev ACCTGAAGATACCGTTTGT
RT-qPCR
norme saeRHomme nouveau T7sae TAATACGACTCACTATAGGGAGAAACTGCCAAAAACACAAGA
saeR2 CCATTATCGGCTCCTTTCA
norme saePHomme nouveau T7-ORF4 TAATACGACTCACTATAGGGAGACAAATTGAAGAAATGAGGAGGTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
saeR saeR4 TAGTCATATCCCCAAACTT
saeU4 CCATTTACGCCTTAACTTTA
saeP uorf4358 TATTATTTGCCTTCATTTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
Purification des protéines
pCG249 Homme nouveau Xho-rny-pETfor GGGGCTCGAGCGAAATTTGTTGCTTCAAAAG
Bam-rny-pETrev GGGGGGATCCTTATTTCGCATATTCTACTGCT
Transcriptions pour la RNase Y in vitro essai de clivage
pCG212 et pCG484 T7saeorf4u TAATACGACTCACTATAGGGAGACAAATTGAAGAAATGAGGAGGTTA
LCgfpmut3.1rev1 TCTTTTGTTTGTCTGCCAT
But . Modèle . Nom . Séquence.
saeP mutant de délétion
ISP479C Kpnsae-pour CGGGGTACCATACTACAGTTTTACATT
Kpn-ORF4-rev ACCTCGGTACCCTGTTCTTACGACCTCTAAAG
HybridORF4a-rechts TAAAAGTTCGCTAGATAGGGGTCCCGCCGTATGATTTCACAGCC
Liens hybrides TCCAATTCTCGTTTTCATACCTCGGAGCTAACTCCTCATTTCTTCAATTT
Newman29 kanR-pour CCGAGGTATGAAAACGAGAATTGG
kanR-rev GGGACCCCTATCTAGCGAACTTT
sae–gfp fusion dans un plasmide intégratif (pCG188)
Eco-sae-pour GCGTGAATTCTTATTGTGGCAAAAGGTTT
Eco-sae1283rev CGTGAATTCTGACGTCGTATTGTGCAACTA
Eco-sae1014rev GGGAATTCTTATGTGAACAAGGAAGGTGTTT
contrôler les PCR gfp-rev-all GGTATCACCTTCAAACTTGACTT
pCG213 pcwsae19 DelP2for TCAATATATATACCATAAGATTGC
DelP2rev GCAATCTTATGGTATATATATTGA
pCG218 pcwsae19 DelST-orf4for AGAGCACATAAGAAACACTTCCT
DelST-orf4rev AGGAAGTGTTTCTTATGTGCTCT
pCG219 pcwsae19 DelST5pour TCAATGGAAAGCATATATACAACT
DelST5rev AGTTGTATATATGCTTTCCATTGA
pCG223 pcwsae19 DelP2longfor TCAATGGAAAGCAAACACTTCCT
DelP2longrev AGGAAGTGTTTGCTTTCCATTGA
pCG379 pCG218 DelST5rev AGTTGTATATATGCTTTCCATTGA
DelST5pour TCAATGGAAAGCATATATACAACT
pCG301 pcwsae19 hybridesaePdelrev CTTTCCATTGAGTAACCTTGATCTTGTGA
hybridesaePdelfor CACAAGATCAAGGTTACTCAATGGAAAGC
pCG392 pcwsae19 hybridepCG392rev TCAAGCTCTAAAAAAATTTAGATTTAATAGTTGTATATAT
hybridepCG392pour ATATATACAACTATTAAATCTAAATTTTTTTAGAGCTTGAT
pCG394 pcwsae19 hybridepCG394rev TGTGCTCTGCAATCTTATGGATTGAAAAAAGGAAAGTATG
hybridepCG394pour CATACTTTCCTTTTTTCAATCCATAAGATTGCAGAGCACA
pCG484 pcwsae19 Hybrid-Rrs-Counter-rev CGATTTGTAGTGTTATGTGA
Hybride-Rrs-Compteur-pour TCACATAACACTACAAATCGTTTATATAAATTACACACAAT
pCG589 pCG212 Q5SDMpCG212R ATATATTGAAAAAAGGAAAAGTATGATTTC
Q5SDMpCG212F ATACAACTATCAAATCCCATAAGATTG
sae–gfp fusion dans un plasmide réplicatif (pCG246)
pCG599 pCG212 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG600 pCG484 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG601 pCG392 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG616 pCG589 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
pCG618 pCG599 Q5SDMpCG618F AAGACCGCAGAGCACATAAGTAAATTTTTTTAG
Q5SDMpCG618R AGGGGAGTTAATAGTTGTATATATATTGAAAAAAAGG
pCG620 pCG223 Gibson-saeconstr-pour ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGGCAAAAGGTTTATAAATTTTAATAC
Gibson-saeconstr-rev ATCCCCGGGTACCGAGCTCGAATTCTTACAAACAAAAAGCGGATTAC
Complément RNase Y
pCG322 RN6390 RecA-dig-for GTCAAGGTAAGGAAAATGTT
hybride-Rny-delKD-rev TGCACCTGGACGAGCTACATTTTGACCGT
hybride-Rny-delKD-pour ACGGTCAAAATGTAGCTCGTCCAGGTGCA
SAV1287-rév AACAATTTGTTGCAATTG
BamHI-RNY-pour CCGGATCCGTTAAACTTAGCAAATATCCT
EcoRI-RNY-rev CGAATTCCTCAACTTAGAAATAAATCCTA
pCG596 pCG296 Q5SDMpCG296R GCTCGTTTCGCTAATGTC
Q5SDMpCG296F TGGACTTTTAGCTGCTGTTGGTAAAGCAATTGATC
Course
Adaptateur ARN 5΄ CTAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATA
gfp-rev1 TCTTTTGTTTGTCTGCCAT
Course 2 Course 2 GTATTGCGGTACCCTTGT
gfp-rev-all GGTATCACCTTCAAACTTGACTT
Sondes DIG
gfppCG188 gfp-creuser-pour CACTTGTCACTACTTTCGGTT
gfp-dig-rev TCTCTCTTTTCGTTGGGAT
saePRN6390 uorf4358 TATTATTTGCCTTCATTTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
rnyRN6390 SAV1286dig-pour TATTAGAGAAGCAGGTGAACA
SAV1286dig-rev TCTTCAGGAGATACAATCACTC
rny 5 premierRN6390 RNY-creuser-pour2 TTCATATAAAGAGCAAACCC
RNY-dig-rev2 TTTTGATATTGTCAGCTTCT
rnjARN6390 sav1089digfor CACCGATACCACTACCAT
sav1089digrev ACCTGAAGATACCGTTTGT
RT-qPCR
norme saeRHomme nouveau T7sae TAATACGACTCACTATAGGGAGAAACTGCCAAAAACACAAGA
saeR2 CCATTATCGGCTCCTTTCA
norme saePHomme nouveau T7-ORF4 TAATACGACTCACTATAGGGAGACAAATTGAAGAAATGAGGAGGTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
saeR saeR4 TAGTCATATCCCCAAACTT
saeU4 CCATTTACGCCTTAACTTTA
saeP uorf4358 TATTATTTGCCTTCATTTTA
lorf4616 ACCTTTTGATGATTTGTAGTTAG
Purification des protéines
pCG249 Homme nouveau Xho-rny-pETfor GGGGCTCGAGCGAAATTTGTTGCTTCAAAAG
Bam-rny-pETrev GGGGGGATCCTTATTTCGCATATTCTACTGCT
Transcriptions pour la RNase Y in vitro essai de clivage
pCG212 et pCG484 T7saeorf4u TAATACGACTCACTATAGGGAGACAAATTGAAGAAATGAGGAGGTTA
LCgfpmut3.1rev1 TCTTTTGTTTGTCTGCCAT

Mutant de délétion saeP et double mutant saeP rny

Remplacement du saeP locus avec une cassette de résistance à la kanamycine (kan) a été obtenu par amplification en chaîne par polymérase (PCR) chevauchante. L'amplicon résultant a été digéré avec KpnI et cloné dans pBT2 (32). Pour profiter de la sélection bleu-blanc, les fragments de fusion ont ensuite été sous-clonés dans les sites EcoRI et Sali de pMAD (33). Le plasmide résultant, pCWSAE30, a été vérifié et transformé dans la souche à restriction déficiente RN4220, suivi d'une mutagenèse comme décrit précédemment (33). Le mutant (appelé RN4220-30) a été vérifié par PCR et électrophorèse sur gel en champ pulsé. La mutation résultante a été transduite dans Newman, donnant la souche Newman-30. Les saeP rny double mutant (appelé Newman-217-30) a été obtenu par transduction du rny::ermC mutation de RN4220-217 (11) dans Newman-30.

Construction de fusions sae-gfp

La construction des plasmides d'intégration a été réalisée en utilisant pCG188 (11), qui permet l'intégration du plasmide dans le euh lieu. Différentes suppressions dans le sae région couvrant le promoteur P1 jusqu'en amont du promoteur P3 ont été introduites par PCR se chevauchant à l'aide d'oligonucléotides et de modèles répertoriés dans le tableau 2. Les amplicons ont été ligaturés dans le pCG188 digéré par EcoRI pour générer les différents plasmides répertoriés dans le tableau 1. L'orientation et la séquence correctes des inserts ont été vérifiés par PCR en utilisant un oligonucléotide spécifique en amont avec gfp-rev-all, et par séquençage de Sanger avant intégration dans le gène de la lipase de S. aureus CYL316 ( 34). Les plasmides intégrés ont ensuite été transduits dans le dispositif expérimental approprié S. aureus souches. Tous les transductants ont été vérifiés par PCR. Pour le clonage de constructions sae-gfp dans le plasmide réplicatif pCG246, le sae-gfp La région des plasmides pCG212, pCG392, pCG484 et pCG223 a été sous-clonée par assemblage Gibson en utilisant les oligonucléotides énumérés dans le tableau 2 pour générer respectivement pCG599, pCG600, pCG601 et pCG620. Les plasmides ont été vérifiés par séquençage Sanger, clonés dans DC10B puis transférés dans des électro-compétents S. aureus souches.

Construction de la construction sae-gfp avec CS muté ou structure secondaire mutée

Des mutations ponctuelles ont été introduites dans des constructions sélectives par mutagenèse dirigée (kit SDM Q5, New England Biolabs) selon les instructions du fabricant en utilisant les oligonucléotides répertoriés dans le tableau 2. La mutation CS (C/T) dans le sae le site de clivage a été introduit dans le plasmide pCG212 pour générer le plasmide pCG589. Les sae-gfp région dans le plasmide pCG589 a ensuite été sous-clonée dans le plasmide réplicatif pCG246 par assemblage Gibson en utilisant les oligonucléotides énumérés dans le tableau 2 pour générer pCG616. Des mutations ponctuelles pour empêcher la formation de structure secondaire en aval de la CS (figure 6C) ont été introduites directement dans le plasmide pCG599 pour générer les plasmides pCG618. Tous les plasmides ont été vérifiés par séquençage Sanger, clonés dans DC10B et transférés dans des électro-compétents S. aureus souches.

Construction de souches complémentées par la RNase Y avec une délétion ou des mutations (H367A, D368A) dans son site actif

Une délétion de 300 pb dans le site actif de la RNase Y a été introduite par PCR chevauchante en utilisant les oligonucléotides énumérés dans le tableau 2. L'amplicon a été cloné dans pCG246 digéré par BamHI/EcoRI pour générer le plasmide pCG322. Les mutations H367A et D368A dans le site actif de la RNase Y ont été introduites dans le plasmide pCG296 par mutagenèse dirigée (kit SDM Q5) selon les instructions du fabricant (New England Biolabs) pour générer le plasmide pCG596. Les deux plasmides ont été clonés dans E. Coli DC10B puis introduit dans Newman rny mutant.

Isolement d'ARN, hybridation Northern blot et RT-qPCR quantitative

L'isolement de l'ARN et l'analyse Northern blot ont été effectués comme décrit précédemment (35). Brièvement, les bactéries ont été lysées dans 1 ml de réactif TRIzol (Invitrogen) avec 0,5 ml de billes de zircone-silice (0,1 mm de diamètre) dans un homogénéisateur à grande vitesse. L'ARN a ensuite été isolé comme décrit par le fabricant. Pour l'analyse Northern blot, des sondes d'ADN marquées à la digoxigénine (DIG) pour la détection de transcrits spécifiques ont été générées à l'aide d'un kit PCR de marquage DIG tel que décrit par le fabricant (Roche Life Science) avec les oligonucléotides répertoriés dans le tableau 2.

L'abondance de transcription de saeR et saeP à partir de trois expériences indépendantes a été déterminé par RT-qPCR en temps réel (exécuté en double) comme décrit précédemment (36). Brièvement, 5 ug de chaque échantillon d'ARN ont été traités avec de la DNase I pendant 30 min à température ambiante, et la réaction a été arrêtée avec un réactif d'inactivation de la DNase (Invitrogen). L'ARN a ensuite été dilué à 1:10, et une qRT-PCR en une étape a été réalisée avec le kit d'amplification pour SYBR Green (Roche Life Science) en utilisant les oligonucléotides appropriés répertoriés dans le tableau 2.

Pour la quantification, des transcrits d'ARN spécifiques à la séquence pour saeR et saeP ont été préparés comme décrit précédemment (36). En bref, des amorces spécifiques d'un gène avec une extension 5', y compris la séquence du promoteur T7 (tableau 2), ont été utilisées pour la PCR standard. Piloté par T7 in vitro la transcription a été réalisée en utilisant un test de transcription standard (T7-MEGAshortscript Invitrogen). Après traitement à la DNase I, l'ARN a été récupéré à l'aide du kit MEGAclear (Invitrogen) et la quantification de l'ARN a été réalisée par spectrophotométrie. La pureté a été vérifiée sur gels d'agarose dénaturants et rapport A260/280. Les courbes standard des standards d'ARN spécifiques à la séquence ont été générées par dilution en série (1 × 10 6 , 3,16 × 10 5 , 1 × 10 5 , 3,16 × 10 4 , 1 × 10 4 , 3,16 × 10 3 et 1 × 10 3 ), et les nombres de copies des transcrits d'échantillons ont été calculés à l'aide du logiciel light cycler 480 (quantification absolue/2e dérivée max, Roche Life Science). Amplification de saeP et saeR s'est produite avec une efficacité de 1,85 et 1,89 et une erreur de 0,012 et 0,011 respectivement.

5΄ Amplification rapide des extrémités d'ADNc

5' L'amplification rapide des extrémités d'ADNc (RACE) a été réalisée comme décrit précédemment (11). Brièvement, l'ARN total a été isolé et l'ARNr a été éliminé en utilisant MICROBExpress (Invitrogen). Un adaptateur 5' d'ARN spécifique (tableau 2) a ensuite été ligaturé à l'ARN. Après extraction au phénol/chloroforme et précipitation à l'éthanol, l'ARN a été soumis à une transcription inverse en utilisant l'oligonucléotide gfp-rev1. La PCR nichée a été réalisée en utilisant les oligonucléotides Race 2 et gfp-rev-all (tableau 2). L'amplicon PCR a été détecté sur un gel d'agarose à 3%, élué, cloné dans pCRII-TOPO (Invitrogen) et séquencé.

Purification des protéines et in vitro essai

Purification des protéines

Pour construire le plasmide pour la surproduction de RNase Y avec His-Tag N-terminal, la séquence codante du rny Le gène excluant les 24 premiers résidus comprenant un domaine transmembranaire putatif a été amplifié par PCR en utilisant les amorces répertoriées dans le tableau 2. L'amplicon a été ligaturé dans le vecteur pET-11b digéré par Xhol/BamHI (Novagen), résultant en pCG249. E. coli BL21 (DE3) transformé avec pCG249 ou avec un plasmide vide (comme contrôle) a été cultivé dans un bouillon Luria-Bertani contenant 100 ug ml -1 d'ampicilline et 25 ug ml -1 de chloramphénicol à 37°C jusqu'à une DO600 de 0,5. L'expression de la protéine a été induite dans les deux souches BL21 (pour l'expression de la RNase Y et le contrôle vide) avec 1 mM d'IPTG pendant 2 h. Les cellules bactériennes ont été récoltées par centrifugation et mises en suspension dans du tampon de lyse (100 mM NaH2Bon de commande4, Tris 10 mM, ire 8 M et imidazole 10 mM pH 8). Un cocktail d'inhibiteur de protéase sans EDTA (Roche Life Science) et du lysozyme (1 mg ml -1 ) ont été ajoutés et le mélange a été agité à température ambiante pendant 30 min. La lyse complète a été obtenue par sonication. L'homogénat résultant a été centrifugé à 10000 × g pendant 30 min pour sédimenter les débris cellulaires. Un total de 1 ml de suspension Ni-NTA à 50 % (Quiagen) a été ajouté à 4 ml de lysat et mélangé doucement en secouant pendant 60 min. La purification sur colonne a ensuite été effectuée en suivant les instructions du fabricant (Quiagen). Les fractions éluées ont été analysées par électrophorèse sur gel de dodécylsulfate de sodium-polyacrylamide pour vérifier la pureté. Les fractions contenant la protéine recombinante ont été collectées et dialysées contre HEPES 20 mM, NaCl 100 mM, glycérine 30%, MgCl2 1 mM et désoxycholate de sodium 0,2% pendant 24 h à 4°C. La procédure de purification a été réalisée en parallèle en utilisant BL21 avec pET-11b et utilisé comme contrôle dans les tests d'activité.

Activité enzymatique

Pour surveiller l'activité enzymatique, un dosage de l'activité phosphodiestérase contre 1 mM de bis-pNpp (Roche Life Science) a été utilisé, comme décrit précédemment (27). La RNase Y recombinante a été ajoutée à HEPES 20 mM et NaCl 100 mM à pH 8 contenant 1 mM de MnCl2. Le substrat chromogène bis-pNPP (p-nitrophényl phosphate) a été ajouté à 1 mM. Les réactions ont été réalisées dans des volumes de 100 ul dans des plaques de microtitrage à 96 puits à 37°C. L'hydrolyse du bis-pNPP a été surveillée en mesurant l'augmentation de l'absorbance à 405 nm à l'aide du lecteur Infinite 200 ProSeries (Tecan).

Test de clivage de la RNase Y

Des transcrits d'ARN spécifiques à la séquence pour les constructions pCG212 et pCG484 ont été préparés par in vitro transcription à l'aide des amorces répertoriées dans le tableau 2. in vitro la transcription a été réalisée dans un test de transcription standard (T7-MEGAshortscript). Après traitement à la DNase I, l'ARN a été récupéré à l'aide du kit MEGAclear (Invitrogen) et la quantification de l'ARN a été réalisée par spectrophotométrie. Le test de clivage de la RNase Y a été réalisé en utilisant 0,125 µg de substrat ARN et purifié 1,36 µM de RNase Y ou de dialysat témoin de cellules Bl21, pET-11b dans un volume réactionnel de 10 µl (20 mM HEPES pH 8, 100 mM NaCl, 1 mM MnCl2 ou 8 mM de MgCl2). Les réactions ont été incubées pendant 10 minutes à 30°C. Après précipitation à l'éthanol, l'ARN a été dissous dans 10 l de tampon de charge (50 % de formamide, 6,5 % de formaldéhyde, 3 g de bromure d'éthidium, dans 40 mM de tampon acide 3-(N-morpholino) propanesulfonique) et l'ARN a été chargé sur un gel d'agarose dénaturant (1% agarose, 1,8% de formaldéhyde dans un tampon acide 3-(N-morpholino)propanesulfonique 40 mM). Les transcriptions ont été détectées par analyse Northern Blot en utilisant gfp Sondes DIG créées comme décrit ci-dessus.


Une méthode simple et efficace pour l'extraction de l'ADN polymérase Taq

ADN polymérase thermostable (Taq Pol Ι) de Thermus aquatique a été largement utilisé en PCR, qui était généralement extrait avec la méthode Pluthero's. La méthode utilisait du sulfate d'ammonium pour précipiter l'enzyme, et elle économisait des efforts et de l'argent mais pas du temps. De plus, nous avons constaté que 30 à 40 % d'activité de la Taq Pol I étaient perdues à l'étape de précipitation au sulfate d'ammonium et que le produit contenait une petite quantité d'ADN.

Résultats

Nous avons fourni une nouvelle méthode simplifiée et peu coûteuse pour purifier la Taq Pol Ι après surproduction de l'enzyme dans Escherichia coli, qui a utilisé de l'éthanol au lieu du sulfate d'ammonium pour précipiter l'enzyme. Le précipité peut être directement dissous dans le tampon de stockage sans dialyse. De plus, la contamination par l'ADN et l'ARN a été éliminée avec la DNase I et la RNase A avant la précipitation, et la procédure d'extraction a été optimisée. Nos améliorations augmentent le taux de récupération et l'activité spécifique de l'enzyme, et économisent du travail, du temps et des coûts.

Conclusion

Notre méthode utilise de l'éthanol, de la DNase I et de la RNase A pour purifier la Taq Pol Ι, simplifie l'opération et augmente le taux de récupération et la qualité de l'enzyme.


Question RNase et EtOH - Biologie

Mary Ann Emanuele, M.D., est professeure au département de médecine, au département de biochimie moléculaire et cellulaire et à la division de recherche sur les drogues d'abus, Loyola University Stritch School of Medicine, Maywood, Illinois.

Nicholas V. Emanuele, M.D., est professeur au département de médecine, à la division de recherche sur les drogues et abus, à la Loyola University Stritch School of Medicine, à Maywood, dans l'Illinois, et membre du personnel médical à l'hôpital des anciens combattants, à Hines, dans l'Illinois.

La consommation d'alcool affecte les trois parties de l'axe hypothalamo-hypophyso-gonadique (HPG), un système de glandes endocrines et d'hormones impliquées dans la reproduction masculine. La consommation d'alcool est associée à un faible taux de testostérone et à des niveaux modifiés d'hormones de reproduction supplémentaires. Les chercheurs étudient plusieurs mécanismes potentiels des dommages causés par l'alcool. Ces mécanismes sont liés au métabolisme de l'alcool, aux dommages cellulaires liés à l'alcool et à d'autres réactions hormonales associées à la consommation d'alcool. Il a également été démontré que la consommation chronique d'alcool chez les rats mâles affecte leur capacité de reproduction et la santé de leur progéniture. Mots clés : axe hypothalamo-hypophyso-gonadique effets sur la reproduction de l'AODU (consommation d'alcool et d'autres drogues) appareil reproducteur masculin testicules oxydation de l'oxyde nitrique métabolisme de l'éthanol en acétaldéhyde apoptose hormone de libération de l'hormone lutéinisante fertilité opioïdes

Le système endocrinien, qui est composé de plusieurs organes producteurs d'hormones dans tout le corps, fait partie intégrante de toutes les fonctions normales du corps, y compris la croissance, le développement, le métabolisme et la reproduction. Cet article passe en revue les recherches sur l'effet de la consommation d'alcool sur le système endocrinien impliqué dans la reproduction masculine, l'axe hypothalamo-hypophyso-gonadique (HPG). Ce système de glandes endocrines et d'hormones comprend une région du cerveau appelée hypothalamus, l'hypophyse, située à la base du cerveau et des gonades mâles (testicules). L'article met également en évidence de nouvelles stratégies prometteuses pour prévenir ou inverser les effets nocifs de l'alcool sur le système reproducteur masculin et décrit les recherches portant sur les mécanismes moléculaires par lesquels l'alcool agit sur ce système.

APERÇU DU SYSTÈME REPRODUCTEUR MASCULIN

Des trois composants de l'axe HPG, l'hypothalamus et l'hypophyse ont uniquement des fonctions régulatrices, qui sont médiées par les hormones qu'ils produisent et sécrètent, comme décrit dans le paragraphe suivant. Le troisième composant - les testicules - produit également des hormones clés, dont la testostérone, qui contrôlent les caractéristiques et les comportements sexuels masculins. De plus, les testicules sont responsables de la production de spermatozoïdes.

L'hypothalamus produit l'hormone de libération de l'hormone lutéinisante (LHRH), qui est libérée par impulsions dans un système de vaisseaux sanguins qui relient l'hypothalamus et l'hypophyse. En réponse au signal LHRH, l'hypophyse produit deux hormones protéiques appelées gonadotrophines. Ces deux hormones gonadotrophiques - l'hormone lutéinisante (LH) et l'hormone folliculo-stimulante (FSH) - sont ensuite libérées dans la circulation générale de l'organisme et agissent principalement au niveau des gonades. Chez les hommes, la LH stimule la production de testostérone à partir de cellules spécialisées appelées cellules de Leydig. La FSH est importante pour la maturation des spermatozoïdes dans un autre compartiment des testicules, l'épididyme. La testostérone circule dans le sang vers l'unité hypothalamo-hypophysaire et régule la production et la sécrétion ultérieures de LHRH et de LH (voir figure 1). Lorsque le système fonctionne normalement, un faible niveau de testostérone entraîne une augmentation des gonadotrophines hypophysaires. La prolactine, une troisième hormone de reproduction synthétisée dans l'hypophyse, est importante pour la synthèse et la sécrétion normales de LHRH.

Figure 1 L'axe hypothalamo-hypophyso-gonadique. L'hypothalamus produit l'hormone de libération de l'hormone lutéinisante (LHRH), qui est libérée dans l'hypophyse. En réponse au signal LHRH, l'hypophyse produit l'hormone lutéinisante (LH) et l'hormone folliculo-stimulante (FSH). Chez les hommes, la LH stimule la production de testostérone et la FSH est importante pour la maturation des spermatozoïdes. La testostérone circule dans le sang vers l'unité hypothalamo-hypophysaire et régule la production et la sécrétion ultérieures de LHRH et de LH.

REMARQUE : + = effet stimulant - = effet inhibiteur.

De faibles niveaux de testostérone (c. Azad et al. 1991 Berczi et al. 1981 Hadley 1988). Chacune de ces conditions peut causer des problèmes de santé importants. Ces effets d'un faible taux de testostérone sont plus importants chez les hommes adultes qui ont un faible taux de testostérone depuis l'adolescence que chez les hommes adultes dont le taux de testostérone n'est diminué qu'à l'âge adulte (Hadley 1988 Yen et Jaffe 1991). Un adolescent ou un adolescent qui subit une diminution intermittente à court terme de la testostérone ou un hypogonadisme permanent est prédisposé à éprouver ces problèmes plus tard dans la vie.

La recherche sur les animaux a systématiquement démontré une association entre la consommation d'alcool aiguë (c'est-à-dire une fois, une fois) et chronique (c'est-à-dire à long terme) et un faible taux de testostérone. À mesure que les niveaux de testostérone diminuent, les niveaux de LH et de FSH devraient augmenter pour stimuler la production de plus de testostérone. Cependant, des études sur de jeunes rats mâles (c. Cela suggère que les cellules hypothalamiques qui produisent la LHRH ne fonctionnent pas correctement lorsque la rétroaction normalement fournie par la testostérone est supprimée (c'est-à-dire lorsque les niveaux de testostérone diminuent). Ainsi, il semble que les effets néfastes de l'alcool sur la reproduction soient médiés aux trois niveaux de l'unité reproductrice masculine : l'hypothalamus, l'hypophyse et les testicules.

L'ALCOOL ET LES TESTICULES

La plupart des études sur les effets de l'alcool sur la reproduction mâle ont été menées chez le rat parce que le modèle du rat imite le système reproducteur mâle humain. La recherche a démontré que l'exposition aiguë et chronique à l'alcool est associée à de faibles niveaux de LHRH hypothalamique et de LH hypophysaire chez l'adulte (Cicero 1982 Salonen et al. 1992) et le rat mâle pubère, et d'autres études ont suggéré que l'alcool inhibe la sécrétion de testostérone par le testicules aussi (Little et al. 1992). Par exemple, plusieurs études ont examiné les effets de l'alcool sur la synthèse de la testostérone, qui se produit via la voie de biosynthèse de la testostérone. Cette voie consiste en une série de précurseurs stéroïdiens de la testostérone et des enzymes respectives nécessaires pour synthétiser chaque précurseur du précédent (Hadley 1988) (voir figure 2). Pour plusieurs raisons liées aux différences de conception expérimentale, il n'est pas possible de conclure précisément où l'alcool agit dans la voie de synthèse de la testostérone, bien qu'il semble probable qu'il existe plus d'un site d'action. Les chercheurs étudient actuellement les effets de l'alcool sur les étapes moléculaires faisant partie intégrante de la fabrication des enzymes de la voie de la testostérone et sur les précurseurs stéroïdiens de la testostérone. Les chercheurs explorent également des stratégies pour prévenir les effets suppressifs de l'alcool sur la synthèse de la testostérone. Une de ces stratégies consiste à donner à des rats mâles des pastilles de testostérone pour remplacer la testostérone. D'autres méthodes consistent à bloquer la dégradation de la testostérone avec des inhibiteurs de l'aromatase (l'aromatase est une enzyme clé impliquée dans la conversion de la testostérone en œstrogène) comme le Fadrozol.

Figure 2 Voie de biosynthèse de la testostérone. Plusieurs enzymes sont nécessaires pour synthétiser la testostérone. Ceux-ci sont indiqués à droite des flèches. Les flèches indiquent les différents précurseurs stéroïdes de la testostérone qui sont synthétisés à chaque étape.

StAR = protéine régulatrice aiguë stéroïdogène

Mécanismes des dommages testiculaires induits par l'alcool

Bien qu'il soit bien connu que l'abus d'alcool chronique produit un dysfonctionnement sexuel et altère la production de sperme chez les humains et les animaux (Yen et Jaffe 1991), les mécanismes de ces dommages induits par l'alcool n'ont pas été entièrement expliqués. Plusieurs mécanismes possibles sont décrits ci-dessous.

Opioïdes. Les opioïdes testiculaires sont des molécules messagères similaires à la morphine qui, lorsqu'elles sont produites dans les testicules, suppriment la synthèse de testostérone. Il a été démontré qu'un opioïde, connu sous le nom de bêta-endorphine, augmente avec la consommation d'alcool aiguë et chronique et peut donc être un lien entre la consommation d'alcool et les lésions testiculaires. Par exemple, la bêta-endorphine produite dans les testicules supprime la production et la libération de testostérone testiculaire (Gianoulakis 1990). De même, la bêta-endorphine produite dans l'hypothalamus entraîne une diminution des taux de LHRH. De plus, les opioïdes peuvent augmenter la mort cellulaire programmée (c'est-à-dire l'apoptose) (Yin et al. 1999 Nanji et Hiller-Sturmh fel 1997). L'apoptose au niveau gonadique entraînerait la mort à la fois des cellules de Leydig et des cellules séminifères, qui sont des cellules impliquées dans la formation et la maturation des spermatozoïdes, entraînant non seulement une baisse de la testostérone, mais également une diminution de la production de spermatozoïdes. Chez les rats mâles adultes et pubères, le traitement avec les antagonistes des opioïdes (c. .

L'oxyde nitrique. Une autre façon de réduire les effets nocifs de l'alcool sur la production de testostérone implique l'oxyde nitrique (NO), un gaz omniprésent qui entraîne la dilatation des vaisseaux sanguins ou la vasodilatation. Le NO est synthétisé dans les testicules par une enzyme clé, la NO synthase (NOS), et l'inhibition de cette enzyme par une variété d'inhibiteurs de NOS empêche avec succès la diminution de la testostérone associée à la consommation d'alcool (Adams et al. 1992). Par conséquent, les futures interventions visant à prévenir ou à inverser la suppression gonadique induite par l'alcool (c.

Oxydation. L'oxydation 1 ( 1 Les réactions d'oxydation sont celles qui éliminent l'hydrogène d'une substance ou lui ajoutent de l'oxygène (ou les deux).) de l'alcool, un processus qui se produit dans le cadre du métabolisme de l'alcool, génère des sous-produits appelés oxydants qui peuvent contribuer à endommager les cellules et peut jouer un rôle dans les lésions tissulaires induites par l'alcool dans les testicules. Un déséquilibre entre les oxydants et les antioxydants (c. L'augmentation du stress oxydatif est un mécanisme bien accepté des lésions tissulaires induites par l'alcool, en particulier dans le foie (Sies 1997 Aleynik et al. 1998 Polavarapu et al. 1998), le cœur et le système nerveux central, et certaines informations indiquent que cela se produit dans les testicules (Emanuele et al. 2001). La consommation d'alcool peut induire des dommages oxydatifs soit en augmentant la production de composés toxiques appelés radicaux libres, soit en diminuant les niveaux d'antioxydants.

Certains oxydants produits par le métabolisme de l'alcool sont connus sous le nom d'espèces réactives de l'oxygène (ROS). Ceux-ci comprennent le superoxyde anionique, le peroxyde d'hydrogène, les radicaux hydroxyle et les espèces réactives à l'azote telles que le NO. Le métabolisme de l'alcool et de l'acétaldéhyde, principal produit du métabolisme de l'alcool, produit des ROS hautement toxiques. Certaines données suggèrent que l'acétaldéhyde est en fait plus toxique que l'alcool pour la production de testostérone, modifiant le processus de production de testostérone en inhibant la protéine kinase C, une enzyme clé dans la synthèse de la testostérone (Anderson et al. 1985 Chiao et Van Thiel 1983). Des recherches supplémentaires ont montré que les hommes souffrant d'alcoolisme chronique et d'hypogonadisme éliminent en fait l'alcool plus rapidement, accumulant moins d'acétaldéhyde. Étant donné que l'accumulation d'acétaldéhyde dans le corps est nauséabonde, une clairance accrue de ce sous-produit pourrait entraîner une réduction des effets secondaires gastro-intestinaux liés à la consommation d'alcool (par exemple, gêne abdominale et vomissements) chez les hommes ayant un faible taux de testostérone. Cela peut augmenter le risque de développer un problème d'alcool, car une personne qui ne ressent pas les effets secondaires gastro-intestinaux négatifs de la consommation d'alcool sera plus susceptible de continuer à boire, souvent en plus grandes quantités (Vaubourdolle et al. 1991).

Dommages cellulaires. Étant donné que les membranes testiculaires sont riches en molécules connues sous le nom d'acides gras (c. suite à une consommation aiguë ou chronique d'alcool. Les dommages causés par la peroxydation peuvent être atténués par une supplémentation alimentaire en vitamine A (Sies 1997). La vitamine A, agissant comme un antioxydant, stabilise les membranes cellulaires testiculaires en réduisant la peroxydation lipidique et prévient l'atrophie induite par l'alcool qui se produit chez les animaux ne recevant pas de régimes enrichis en vitamine A. Prises ensemble, ces observations suggèrent que la peroxydation accrue des lipides testiculaires qui se produit après la consommation d'alcool peut être un facteur important dans la pathogenèse des lésions gonadiques associées à l'alcool et qu'une alimentation riche en vitamine A peut aider à contrer ces lésions. Des recherches sont actuellement menées pour examiner le rôle des lésions oxydatives dans l'hypogonadisme induit par l'alcool.

En plus des dommages membranaires, d'autres types de dommages cellulaires peuvent être associés à des dommages testiculaires induits par l'alcool. Une forte consommation d'alcool sur de longues périodes entraîne de graves dommages cellulaires qui entraînent la mort cellulaire. La mort cellulaire se produit via deux mécanismes distincts : la nécrose et l'apoptose. La nécrose se produit lorsque l'exposition à un stimulus nocif, tel que l'alcool, provoque la perte des fonctions métaboliques de la cellule et des dommages à la membrane cellulaire. Dans l'apoptose, la cellule participe activement aux processus de mort cellulaire en activant une cascade de réactions biochimiques qui conduisent finalement au rétrécissement cellulaire et à la fragmentation du noyau. Lorsqu'une cellule subit une apoptose, la cellule entière, y compris le noyau, se sépare en de nombreux fragments (c'est-à-dire des corps apoptotiques) (Nanji et Hiller-Sturmh fel 1997).

Dans n'importe quel organe, l'exposition aiguë et chronique à l'alcool induit une nécrose cellulaire ainsi que l'apoptose, et le stress oxydatif joue un rôle crucial dans les deux processus. Cela est également vrai pour la cellule germinale testiculaire (c'est-à-dire une cellule importante dans le développement et la maturation du sperme). Les lésions oxydatives entraînent le dérèglement et finalement la rupture des membranes cellulaires, conduisant à la mort cellulaire nécrotique. De plus, l'oxydation des enzymes peut bloquer les processus métaboliques essentiels au fonctionnement et à la réparation des cellules. L'apoptose est présumée représenter la dernière voie commune des lésions cellulaires induites par les ROS. Ceci est induit directement par les radicaux libres d'oxygène. Bien que l'apoptose des cellules germinales puisse également être déclenchée par divers stimuli régulateurs non hormonaux, y compris les toxines testiculaires, le stress thermique et les agents chimiothérapeutiques, les mécanismes par lesquels ces facteurs hormonaux et non hormonaux régulent l'apoptose des cellules germinales ne sont pas bien compris (Hikim et Swerdloff 1999). L'apoptose peut également être induite indirectement par un déséquilibre entre l'oxydation et la réduction 2 ( 2 Les atomes d'hydrogène qui sont éliminés pendant l'oxydation sont transférés à une autre molécule, qui est ainsi « réduite ». Ainsi, l'oxydation et la réduction sont des processus complémentaires, car la l'oxydation d'une substance entraîne la réduction d'une autre.Ce processus, qui déplace les atomes d'hydrogène dans les deux sens entre les réactions d'oxydation/réduction, aide à maintenir un équilibre approprié entre l'oxydation et la réduction dans la cellule.) processus dans la cellule et par l'expression de molécules favorisant l'inflammation appelées cytokines. Les travaux en cours dans le domaine de l'apoptose induite par l'alcool au niveau gonadique élargiront les connaissances dans ce domaine.

Autres mécanismes potentiels. D'autres explications de la suppression gonadique associée à l'alcool impliquent le métabolisme de l'alcool en acétoacétate, un composé hautement toxique, et d'autres agents toxiques formés à partir de l'acétoacétate, comme le salsolinol (Stumble et al. 1991). De même, l'alcool peut induire des niveaux élevés de prolactine hypophysaire et de cytokines favorisant l'inflammation dans le cerveau, qui peuvent être responsables de la suppression gonadique de la testostérone. Les perturbations d'autres composants du système hormonal qui interagissent avec l'axe HPG, comme la glande surrénale, jouent également un rôle dans la suppression de la testostérone gonadique (Ogilvie et Rivier 1997). Les effets de la maladie du foie sur le métabolisme des stéroïdes gonadiques et les taux circulants de stéroïdes gonadiques sont également importants pour comprendre l'hypogonadisme induit par l'alcool (Lieber 1994). Cependant, ces effets dépassent le cadre de cet examen.

L'ALCOOL ET L'UNITÉ HYPOTHALAMO-PITUITAIRE MASCULINE

Les recherches sur les effets de l'alcool sur l'hypothalamus et l'hypophyse se sont concentrées sur les effets des hormones LHRH, produites par l'hypothalamus, et LH et FSH, produites par l'hypophyse. Alors que certaines études ont rapporté que la sécrétion de LHRH est réduite après une consommation aiguë d'alcool et que d'autres études n'ont rapporté aucun effet (voir Emanuele et al. 1993), la capacité de l'hypothalamus masculin à synthétiser cette hormone importante semble être inchangée par l'alcool à n'importe quelle dose (Emanuele et al. 1993).

La sécrétion de LHRH est étroitement régulée par une série de mécanismes complexes impliquant diverses impulsions nerveuses générées à l'extérieur de l'hypothalamus. L'alcool peut influencer n'importe lequel de ces stimuli. De multiples processus et composés, dont les opioïdes, conduisent à l'activation du générateur d'impulsions de LHRH, la partie de l'hypothalamus responsable de la sécrétion de LHRH (Gianoulakis 1990). D'autres substances chimiques du cerveau et signaux nerveux jouent également un rôle dans la sécrétion de LHRH et peuvent être affectés par l'alcool. Cependant, ce niveau supérieur de l'axe reproducteur, l'hypothalamus, semble être le moins vulnérable aux conséquences délétères de l'alcool.

Les chercheurs ont également évalué l'effet de l'alcool sur la LH et la FSH, les gonadotrophines hypophysaires responsables de la fonction gonadique. Des études chez l'animal et l'homme ont montré que lorsque les niveaux de testostérone diminuent, les niveaux de LH n'augmentent pas comme on pourrait s'y attendre. Cette incapacité de l'hypophyse à répondre de manière appropriée à une baisse de la testostérone implique que l'alcool a un effet central sur l'interaction entre le système nerveux et le système endocrinien (Hadley 1988 Yen et Jaffe 1991).

Des études chez des rats nourris avec de l'alcool ont établi que la diminution des taux de LH résulte d'une altération à la fois de la production de LH et de la sécrétion de LH, et les chercheurs ont tenté d'identifier les étapes spécifiques de la production et de la sécrétion de LH qui sont affectées par l'alcool (Salonen et al. 1992 Emmanuel et al. 1993). La production de LH est initiée par l'interaction de la LHRH libérée par l'hypothalamus avec des récepteurs spécifiques de la LHRH.

Cette interaction active une cascade d'événements enzymatiques dans les cellules hypophysaires. L'alcool pourrait perturber le fonctionnement du récepteur LHRH ou son interaction avec la LHRH, entraînant une diminution de la libération de LH. Aucune preuve n'a été trouvée pour indiquer que l'alcool altère l'interaction de la LHRH avec son récepteur, mais l'alcool peut affecter les événements ultérieurs. Plus précisément, les chercheurs ont signalé que l'alcool altère la fonction de la protéine kinase C, une enzyme clé dans la production de LH, et que l'alcool altère d'autres étapes essentielles à la synthèse et à la sécrétion de LH. Des recherches supplémentaires sur des rats ont montré que l'alcool altère la production de LH en diminuant la capacité du matériel génétique de LH à se lier aux parties de la cellule (c'est-à-dire les ribosomes) où se produit la synthèse des protéines.

En plus de réduire les niveaux de LH dans le sang, l'alcool peut affecter l'activité de la molécule de LH, la rendant moins capable de stimuler la production d'hormones dans les testicules. Comme beaucoup d'autres hormones, la LH n'est pas une simple protéine mais une protéine à laquelle divers glucides sont attachés (c'est-à-dire une glycoprotéine). Le nombre et les types de glucides attachés à la protéine déterminent la capacité de l'hormone à stimuler la production de testostérone (c'est-à-dire sa puissance biologique). De nombreuses variantes de LH existent avec différents glucides attachés et différentes puissances. Il a été démontré que l'alcool entraîne la production de molécules de LH moins puissantes. Par conséquent, les effets délétères de l'alcool sur la fonction LH sont qualitatifs et quantitatifs.

Alors que moins d'informations sont disponibles sur l'effet de l'alcool sur la FSH, la sécrétion de cette gonadotrophine semble également être réduite par l'alcool. Cependant, l'alcool ne semble pas affecter la synthèse de la FSH (Emanuele et al. 1993).

ALCOOL, OPIODES ET REPRODUCTION

La bêta-endorphine opioïde est fabriquée dans l'hypothalamus ainsi que dans d'autres parties du cerveau, dans l'hypophyse et dans les testicules. La bêta-endorphine hypothalamique retient la sécrétion de LHRH hypothalamique et est donc inhibitrice de l'axe HPG. La bêta-endorphine hypothalamique augmente avec l'exposition aiguë et chronique à l'alcool (Gianoulakis 1990), et une augmentation de la bêta-endorphine s'est avérée entraîner la suppression de la LHRH hypothalamique, de la LH hypophysaire et de la synthèse de testostérone, comme indiqué précédemment. Les animaux et les humains exposés à l'alcool ont également des niveaux élevés d'un œstrogène connu sous le nom d'œstradiol. Ceci est pertinent, car l'estradiol est connu pour augmenter la libération de bêta-endorphine. Ainsi, l'alcool peut augmenter les opioïdes à la fois directement et indirectement, bien que l'ampleur du changement soit inconnue.

Étant donné que les opioïdes sont connus pour jouer un rôle dans les lésions oxydatives, il est plausible qu'un traitement par la naltrexone, un bloqueur d'opioïdes, puisse prévenir ces lésions. L'utilisation de la naltrexone pour accomplir une telle prévention est très importante, car la naltrexone est un médicament déjà utilisé en clinique pour réduire les envies d'alcool. Comme indiqué ci-dessus, il a été démontré que les bloqueurs d'opioïdes aident à prévenir l'inhibition de la testostérone induite par l'alcool associée aux opioïdes. Les opioïdes peuvent également jouer un rôle dans la médiation du stress oxydatif et de l'apoptose. Le domaine du blocage des opioïdes mérite une large attention.

EFFETS DE L'EXPOSITION PATERNELLE À L'ALCOOL SUR L'AXE REPRODUCTEUR

Peu d'études se sont penchées sur les effets de la consommation d'alcool du parent mâle sur sa capacité de reproduction et la santé de sa progéniture (Bielawski et Abel 1997 Abel 1995). En tant que modèle de consommation d'alcool chez les adolescents, les chercheurs ont étudié les effets de l'exposition à l'alcool sur des rats mâles péripubères. Cette recherche a démontré les effets délétères de la consommation paternelle d'alcool sur la progéniture. Deux mois d'alimentation avec de l'alcool à des animaux mâles au fur et à mesure qu'ils progressaient jusqu'à la puberté ont entraîné une diminution du poids corporel et des niveaux de testostérone, par rapport aux animaux qui n'ont pas reçu d'alcool. Malgré cela, après une semaine d'abstinence d'alcool, ces animaux ont pu s'accoupler avec succès, bien que l'accouplement réussi entraînant la conception (c'est-à-dire la fécondité) ait été considérablement réduit et le nombre de grossesses réussies ait diminué.

Bien que la taille de la portée des mâles exposés à l'alcool ait été réduite de 46 pour cent, le poids individuel moyen de la progéniture des petits des animaux paternellement exposés à l'alcool était plus élevé. Le rapport mâle-femelle des petits a également été modifié, avec une prépondérance plus élevée de la progéniture mâle de pères nourris à l'alcool. Aucune malformation grave n'a été notée parmi les chiots.

Cependant, les lésions oxydatives testiculaires paternelles ont augmenté, comme le montre l'augmentation de la peroxydation lipidique. L'apoptose des cellules germinales était également élevée chez les pères exposés à l'alcool (Emanuele et al. 2001). Par conséquent, il semble que l'exposition chronique à l'alcool dans le groupe d'âge péripubertaire diminue la fécondité, ce qui peut être médié par une lésion oxydative testiculaire, entraînant une accélération de l'apoptose des cellules germinales chez les pères exposés à l'alcool. C'est un autre domaine passionnant pour une enquête plus approfondie.

ALCOOL, LEPTINE ET REPRODUCTION

La leptine, l'hormone qui régule l'appétit découverte en 1994, a des implications au-delà de son rôle initialement désigné. Il semble avoir un large rôle dans l'axe HPG et au-delà, tant pour les hommes que pour les femmes. Dans l'axe HPG, la leptine semble stimuler la LHRH et la LH mais inhibe l'activité gonadique (Hiney et al. 1999).Chez le rat, 1 mois de consommation d'alcool stimule la leptine (Nicolas et al. 2001), présentant un autre mécanisme potentiel et intrigant de l'hypogonadisme induit par l'alcool.

La recherche au cours des 25 dernières années a considérablement élargi les connaissances sur les effets de l'alcool sur la reproduction masculine. Les domaines fertiles pour l'enquête comprennent les mécanismes des dommages oxydatifs induits par l'alcool et l'apoptose dans les testicules, les conséquences de l'exposition paternelle à l'alcool pour leur progéniture et les effets de la consommation d'alcool sur la leptine et la reproduction masculine. De plus, la prévention pratique de la suppression testiculaire avec la naltrexone et l'inhibition du NO sont des interventions thérapeutiques prometteuses.

ABEL, E.L. Un effet surprenant du traitement paternel à l'alcool sur les fœtus de rats. De l'alcool 12(1):1ע, 1995.

ADAMS, M.L. NOCK, B. TRUONE, R. et CICERO, T.J. Contrôle de l'oxyde nitrique de la stéroïdogenèse : effets endocriniens de la N G -nitro-L-arginine et comparaison avec l'alcool. Sciences de la vie 50 : PL35 / 150 PL40, 1992.

ALEYNIK, S.I. LEO, M.A. ALEYNIK, M.K. et LIEBER, C.S. Augmentation des produits circulants de la peroxydation lipidique chez les patients atteints d'une maladie alcoolique du foie. Alcoolisme : recherche clinique et expérimentale 22: 192𤪴, 1998.

ANDERSON, R.A. JR. QUIGG, J.M. OSWALD, C. et ZANEVELD, L.J. Démonstration d'une barrière hémato-testiculaire fonctionnelle à l'acétaldéhyde. Preuve de l'absence d'effet de l'acétaldéhyde sur la dépression de la testostérone induite par l'éthanol in vivo. Pharmacologie biochimique 34(5):685𤲧, 1985.

AZAD, N. AGRAWAL, L. EMANUELE, M.A. KELLEY, M.R. MOHAGHEGHPOUR, N. LAWRENCE, A.M. et EMANUELE, N.V. Neuroimmunoendocrinologie. Journal américain d'immunologie de la reproduction 26: 160𤪜, 1991.

BERCZI, I. NAGY, E. KOVACS, K. ​​et HORWATH, E. Régulation de l'immunité humorale chez le rat par les hormones hypophysaires. Acta Endocrine 98:506𤯱, 1981.

BIELAWSKI, D.M., et ABEL, E.L. Le traitement aigu de l'exposition paternelle à l'alcool produit des malformations chez la progéniture. De l'alcool 14(4):397𤮁, 1997.

CHIAO, Y.B. et VAN THIEL, D.H. Mécanismes biochimiques qui contribuent à l'hypogonadisme induit par l'alcool chez l'homme. Alcoolisme : recherche clinique et expérimentale 7(2):131𤩶, 1983.

CICERO, T.J. Déficits induits par l'alcool dans l'axe hypothalamo-hypophyso-lutéinisant chez l'homme. Alcoolisme : recherche clinique et expérimentale 6:207𤫇, 1982.

EMANUELE, M.A. HALLORAN, M.M. UDDIN, S. TENTLER, J. EMANUELE, N.V. LAWRENCE, A.M. et al. Effets de l'alcool sur le contrôle neuroendocrinien de la reproduction. Dans : Zakhari, S., éd., L'alcool et le système endocrinien : NIAAA Research Monograph No. 23, Bethesda, MD : Institut national sur l'abus d'alcool et l'alcoolisme, 1993. pp. 89𤩤.

EMANUELE, N.V. LAPAGLI, N. STEINER, J. COLANTONI, A. VAN THIEL, D.H. et EMANUELE, M.A. Exposition paternelle péripubertaire à l'EtOH. Endocrine14(2): 213ץ, 2001.

GIANOULAKIS, C. Caractérisation des effets de l'administration aiguë d'éthanol sur la libération de peptides bêta-endorphines par l'hypothalamus du rat. Journal Européen de Pharmacologie 180:21㪵, 1990.

GIANOULAKIS, C. L'effet de l'éthanol sur la biosynthèse et la régulation des peptides opioïdes. Expérience 45:428𤮣, 1989.

HADLEY M.E. Endocrinologie. Deuxième édition. Englewoods Cliff, NJ : Prentice Hall, 1988.

HIKIM, A.P., et SWERDLOFF, R.S. Contrôle hormonal et génétique de l'apoptose des cellules germinales dans les testicules. Critiques de Reproduction 4:38㫇, 1999.

HINEY, J.K. DEARTH, R.K. LARA, F., III. WOOD, S. SRIVASTAVA, V. et DEES, W.L. Effets de l'éthanol sur la sécrétion de leptine et la libération d'hormone lutéinisante (LH) induite par la leptine chez des rats femelles juvéniles tardifs. Alcoolisme : recherche clinique et expérimentale 23(11): 1785�, 1999.

JACKSON, J., et KLEREKOPER, M. Ostéoporose chez les hommes : diagnostic, physiopathologie et prévention. Médicament 69:137𤪈, 1990.

KLEIN, R., et DUWALL, E.S. Perte osseuse chez l'homme : pathogenèse et considérations thérapeutiques. Endocrinologue 4:252𤫽, 1994.

LIEBER, C.S. Effets hépatiques et métaboliques de l'éthanol : pathogenèse et prévention. Annales de médecine 26(5): 325𤬺, 1994.

LITTLE, P.J. ADAMS, M.L. et CICERO, T.J. Effets de l'alcool sur l'axe hypothalamo-hypophyso-gonadique chez le rat mâle en développement. Journal of Pharmacology and Experimental Therapeutics 263(3):1056�, 1992.

NANJI, A.A., et HILLER-STURMHÖFEL, S. Apoptose et nécrose : deux types de mort cellulaire dans la maladie alcoolique du foie. Alcool Santé et monde de la recherche 21:325𤬺, 1997.

NICOLAS, J.M. FERNANDEZ-SOLA, J. FATJO, F. CASAMITJANA, R. BATALLER, R. SACANELLA, E. et al. Augmentation des taux de leptine circulante dans l'alcoolisme chronique. Alcoolisme : recherche clinique et expérimentale 25(1):83㫰, 2001.

OGILVIE, K.M. et RIVIER, C. Différence entre les sexes dans la réponse de l'axe hypothalamo-hypophyso-surrénalien à l'alcool chez le rat : rôle activationnel des stéroïdes gonadiques. Recherche sur le cerveau 766(1מ):19㪴, 1997.

POLAVARAPU, R. SPITZ, D.R. SIM, J.E. FOLLANSBEE, M.H. OBERLEY, L.W. RAHEMTULLA, A. et al. Une augmentation de la peroxydation lipidique et une altération de la fonction enzymatique antioxydante sont associées à des lésions hépatiques pathologiques dans une maladie hépatique alcoolique expérimentale chez des rats nourris avec des régimes riches en huile de maïs et en huile de poisson. Hépatologie 27: 1317�, 1998.

SALONEN, I. PAKARINEN, P. et HUHTANIEMI, I. Effet du régime alimentaire chronique à l'éthanol sur l'expression des gènes de la gonadotrophine chez le rat mâle. Journal of Pharmacology and Experimental Therapeutics 260: 463𤯃, 1992.

SIES, H. Stress oxydant : Oxydants et antioxydants. Physiologie expérimentale 82:291𤬗, 1997.


Tout est question de solubilité

Premièrement, nous devons savoir pourquoi les acides nucléiques sont solubles dans l'eau. L'eau est une molécule polaire - elle a une charge négative partielle près de l'atome d'oxygène en raison des paires d'électrons non partagées, et des charges positives partielles près des atomes d'hydrogène. En raison de ces charges, les molécules polaires comme l'ADN ou l'ARN peuvent interagir électrostatiquement avec les molécules d'eau, leur permettant de se dissoudre facilement dans l'eau. Les molécules polaires peuvent donc être décrites comme des molécules hydrophiles et non polaires, qui ne peuvent pas facilement interagir avec les molécules d'eau, sont hydrophobes. Les acides nucléiques sont hydrophiles en raison du phosphate chargé négativement (PO3 –) groupes le long du squelette sucre-phosphate.


Diagnostic Diagnostic

Faire un diagnostic pour une maladie génétique ou rare peut souvent être difficile. Les professionnels de la santé examinent généralement les antécédents médicaux, les symptômes, l'examen physique et les résultats des tests de laboratoire d'une personne afin de poser un diagnostic. Les ressources suivantes fournissent des informations relatives au diagnostic et aux tests de cette condition. Si vous avez des questions sur l'obtention d'un diagnostic, vous devez contacter un professionnel de la santé.

Ressources de test

  • Le Registre des tests génétiques (GTR) fournit des informations sur les tests génétiques pour cette condition. Le public visé par le RTM est les fournisseurs de soins de santé et les chercheurs. Les patients et les consommateurs ayant des questions spécifiques sur un test génétique doivent contacter un fournisseur de soins de santé ou un professionnel de la génétique.

INTRODUCTION

Les oligonucléotides antisens (ASO) qui contiennent une portion centrale d'oligodésoxynucléotide flanquée de nucléotides modifiés en 2' aux deux extrémités, appelés ASO gapmer, peuvent s'hybrider avec des ARN complémentaires et déclencher le clivage de la RNase H1, conduisant à une dégradation spécifique de l'ARN (1). ASOs chimiquement modifiés qui contiennent des squelettes phosphorothioate (PS) et différentes modifications 2', par ex. 2′méthoxyéthyle (MOE), peut être délivré à différents tissus et cellules pour déclencher une activité antisens in vivo et in vitro ( 2, 3). Bien que la plupart des ASO soient puissants pour réduire les ARN de ciblage et aient une longue durée d'activité, en réponse courante aux interventions pharmacologiques (4), certains ASO peuvent présenter des effets de tolérance. Par exemple, certaines cibles d'ARNm sont difficiles à réduire avec des ASO gapmers et certains ASO affichent une durée d'activité plus courte que la réduction de cible prolongée qui est généralement observée pour la plupart des ASO. Cependant, on sait très peu de choses sur le(s) mécanisme(s) potentiel(s) responsable(s) de la tolérance à l'ASO.

Il a été montré que les ASO sont actives à la fois dans le noyau et le cytoplasme, où la RNase H1 est présente (5). Par exemple, les pré-ARNm localisés dans le noyau et les ARN non codants peuvent être efficacement réduits par les ASO (6-9). D'autre part, les ARNm matures peuvent également être rapidement dégradés dans le cytoplasme lors de la transfection des ASO ciblant les exons (5). Certains ASO ciblant les exons peuvent réduire à la fois l'ARNm mature et le pré-ARNm, qui sont respectivement enrichis dans le cytoplasme et le noyau. Cependant, certains ASO ciblant les exons peuvent rapidement réduire les niveaux d'ARNm matures mais pas leurs pré-ARNm (5), suggérant une accessibilité différente des ASO à la même séquence présente à la fois dans l'ARNm et le pré-ARNm. Ce point de vue est également soutenu par les observations selon lesquelles les ASO ciblant les snoARN codés par des introns peuvent réduire efficacement les niveaux de snoARN matures, sans affecter les niveaux des pré-ARNm de l'hôte (6). Cependant, l'intermédiaire d'épissage contenant le snoARN peut être dégradé par les ASO (5).

De plus, après l'hybridation ASO-ARN, d'autres protéines peuvent être recrutées dans l'hétéroduplex ASO/ARN, affectant le clivage de la RNase H1, et peuvent moduler le destin de l'ARN en déclenchant différents mécanismes de post-hybridation (3). Par exemple, les protéines Ku70, P54nrb et HspA8 peuvent se lier à l'hétéroduplex ASO/ARN et inhiber le recrutement de la RNase H1 et le clivage de l'ARN (10, 11). Ces observations suggèrent que l'ARN mature et les précurseurs peuvent adopter des structures différentes ou sont associés à différentes protéines, conduisant à une accessibilité altérée aux ASO, très probablement dépendant du site cible ASO présent dans un ARN, et/ou de la localisation de l'ARN dans les cellules. En outre, nous avons récemment également découvert qu'un ASO ciblant l'ARNr 5S réduisait le niveau d'ARNr 5S mature, mais déclenchait l'accumulation d'une espèce d'ARNr pré-5S incomplètement traitée dans le noyau, d'une manière dépendante de l'hybridation ASO/ARN (12). mettant en évidence la complexité des mécanismes antisens potentiels déclenchés par l'hybridation ASO aux ARN cibles.

Dans les cellules de mammifères, la plupart des gènes codant pour les protéines sont transcrits en tant que pré-ARNm dans le noyau, où les pré-ARNm sont traités par élimination des introns (épissage), modification des nucléotides, coiffage 5' et traitement de l'extrémité 3' pour générer des ARNm matures (13-15 ). Les ARNm matures sont ensuite exportés et s'accumulent dans le cytoplasme et sont traduits par les ribosomes (16). Les niveaux d'ARNm à l'état d'équilibre sont déterminés par le taux de synthèse d'ARNm et de dégradation de l'ARNm. Les ARNm subissent normalement un processus de désintégration qui implique le décapage, la désadénylation et les exonucléases telles que XRN1 et les exosomes (17). Cependant, certains ARNm contenant des codons de terminaison prématurée (PTC) peuvent subir une décomposition à médiation non-sens (NMD), qui nécessite des facteurs NMD tels que UPF1, UPF2 et UPF3 (18-20). Deux formes d'UPF3, UPF3A et UPF3B sont exprimées de manière différentielle au cours du développement et peuvent jouer des rôles opposés dans la NMD, avec UPF3A comme répresseur et UPF3B comme activateur (21).

Il a été démontré que les niveaux d'ARNm sont bien tamponnés et que la dégradation ou la dégradation de l'ARNm cytoplasmique est liée à la transcription (22-24), qui peut être médiée par les facteurs de dégradation XRN1 et les protéines complexes CCR4-CNOT (17). Ces protéines font la navette entre le cytoplasme et le noyau d'une manière dépendante de la dégradation de l'ARNm et améliorent la transcription en se liant à la région promotrice (25). De plus, sous certaines mutations génétiques, l'expression de gènes homologues peut être régulée à la hausse par une réponse génétique compensatoire (GCR) ( 26), qui est déclenchée par la dégradation des ARNm mutants contenant PTC probablement par NMD ( 27), mais dans un UPF1 et UPF3B indépendant manière ( 28). Cependant, ce processus nécessite le facteur NMD UPF3A et les protéines du complexe COMPASS, y compris WDR5, ce dernier complexe est requis pour la méthylation des histones (H3K4me3) au site de démarrage de la transcription des gènes compensatoires pour améliorer la transcription (27, 28).

Auparavant, nous avons découvert qu'un ASO ciblant la région de l'exon de l'ARNm de SOD1 réduisait le niveau d'ARNm, mais augmentait de manière surprenante le niveau de son pré-ARNm (5). Cette observation soulève la possibilité que certains ASO puissent réduire progressivement l'activité antisens en raison d'une tolérance médiée par des niveaux accrus de pré-ARNm. Cependant, il n'est pas clair si cette observation est unique à cet ASO et quels mécanismes sous-jacents peuvent être impliqués dans l'augmentation du pré-ARNm induite par l'ASO gapmer. Dans la présente étude, nous avons analysé les effets de plusieurs ASO exoniques ciblant différents ARNm sur les niveaux de pré-ARNm et avons constaté que certains ASO gapmers peuvent augmenter les niveaux de pré-ARNm dans les cellules humaines et murines. De plus, nous avons montré que l'augmentation du pré-ARNm se produit peu de temps après la réduction de l'ARNm, et que la réduction de l'ARNm elle-même est nécessaire mais pas suffisante pour déclencher l'augmentation du pré-ARNm. En outre, nous avons constaté que l'augmentation du pré-ARNm est due à une transcription améliorée et probablement également à un traitement plus lent, dépend de la RNase H1 et de la traduction, et nécessite UPF3A mais pas WDR5. Cependant, la réduction des autres facteurs NMD UPF1, UPF2 et UPF3B n'a pas affecté l'augmentation du pré-ARNm lors du traitement ASO. De plus, le processus d'augmentation du pré-ARNm n'est pas médié par la voie de rétroaction XRN1-CNOT. Il est important de noter qu'un ASO qui a provoqué une augmentation du pré-ARNm a montré une activité réduite après des doses répétées chez les animaux, ce qui correspond aux phénotypes de tolérance aux médicaments. Ensemble, ces résultats suggèrent que certains ASO gapmers peuvent réduire les niveaux d'ARNm dans le cytoplasme tout en déclenchant un mécanisme de rétroaction pour améliorer la transcription du gène correspondant, conduisant à des niveaux accrus de pré-ARNm, ce qui peut émousser l'activité totale de l'ASO.


Introduction

Les tubes polliniques montrent une expansion cellulaire strictement polaire appelée croissance de la pointe, qui est similaire à celle des poils absorbants. Chez certaines espèces végétales, le taux de croissance du tube pollinique peut atteindre des micromètres par seconde (Stone et al., 2004). Pour atteindre une croissance extrêmement rapide, les tubes polliniques ont un besoin énergétique élevé qui nécessite une absorption rapide d'oxygène (Tadege et Kuhlemeier, 1997), et le calcium cytosolique libre ([Ca 2+ ]cyt) a un rôle crucial dans la modulation de l'allongement polaire. Des études récentes ont montré que les espèces réactives de l'oxygène (ROS) étaient une exigence pour la croissance des poils absorbants. Foreman et ses collègues (Foreman et al., 2003) ont utilisé un mutant knock-out à perte de fonction dans AtrbobC/RHD2 pour démontrer que les ROS étaient indispensables à la croissance des poils absorbants et étaient nécessaires pour stimuler l'afflux de Ca 2+ pendant l'élongation des poils absorbants. AtrbobC/RHD2 code pour un superoxyde (O2• − )-productrices de NADPH oxydase (NOX) et le mutant présentaient une formation réduite de ROS à l'extrémité des poils absorbants très courts. Par la suite, Monshausen et ses collègues (Monshausen et al., 2007) ont détecté des oscillations de concentration apoplastique de ROS au sommet des flancs des poils absorbants, ce qui a révélé un nouveau modèle du rôle des ROS dans la croissance des poils absorbants. Sinon, il a été démontré que les ROS localisées à la pointe produites par une enzyme NOX étaient nécessaires pour maintenir le taux normal de croissance du tube pollinique (Potocky et al., 2007). Les ROS sont une conséquence inévitable du métabolisme aérobie et ont diverses fonctions, notamment la défense contre les agents pathogènes et la signalisation cellulaire. Dans les cellules végétales, il existe de nombreuses sources potentielles de ROS, telles que les chloroplastes, les mitochondries et les peroxysomes, et les NADPH oxydases de la membrane plasmique, les peroxydases de la paroi cellulaire et les amine oxydases (Mittler, 2002 Neill et al., 2002). Les mitochondries ont été considérées comme les principaux producteurs de ROS dans les cellules animales et dans les cellules végétales sans chloroplastes, telles que les tubes polliniques. L'O2• − la formation dans les mitochondries est étroitement liée à l'efficacité de couplage entre la chaîne respiratoire et la phosphorylation oxydative. La NADPH oxydase liée à la membrane plasmatique transfère les électrons du NADPH cytoplasmique pour former O2• − , qui subit une réaction de dismutation enzymatique et non enzymatique, produisant immédiatement H2O2, la forme la plus stable de ROS. Les ROS formés dans la membrane plasmique s'accumulent finalement dans les parois cellulaires du tube pollinique.

Poire (Pyrus pyrifolia L.) de la famille des Rosacées, possède un système d'auto-incompatibilité gamétophytique (SI) basé sur la S-RNase. À l'aide d'un système in vitro, notre équipe a identifié les caractéristiques de la S-RNase qui inhibent spécifiquement la germination du pollen et l'allongement du tube (Hiratsuka et al., 2001 Zhang et Hiratsuka, 2000 Zhang et Hiratsuka, 1999). Récemment, il a été confirmé que la S-RNase induit la dépolymérisation du cytosquelette d'actine et la dégradation de l'ADN des tubes polliniques auto-générés (Liu et al., 2007 Wang et al., 2009). Pour identifier si les résultats in vitro reflètent ce qui se passe in vivo, nous avons évalué l'ADN nucléaire des tubes polliniques après différentes pollinisations. Les ROS ont un rôle important dans l'allongement du tube pollinique comme mentionné ci-dessus, et le cytosquelette d'actine est une cible pour les ROS chez la levure (Perrone et al., 2008). Nous avons donc spéculé que la perturbation ROS localisée à la pointe se produit dans la réponse SI de la poire.


Contenu

L'extraction de l'ARN dans les expériences de biologie moléculaire est grandement compliquée par la présence de RNases omniprésentes et robustes qui dégradent les échantillons d'ARN. Certaines RNases peuvent être extrêmement résistantes et leur inactivation est difficile par rapport à la neutralisation des DNases. En plus des RNases cellulaires libérées, plusieurs RNases sont présentes dans l'environnement. Les RNases ont évolué pour avoir de nombreuses fonctions extracellulaires dans divers organismes. [5] [6] [7] Par exemple, RNase 7, un membre de la superfamille RNase A, est sécrétée par la peau humaine et sert de défense antipathogène puissante. [8] [9] Pour ces RNases sécrétées, l'activité enzymatique peut même ne pas être nécessaire pour la fonction exaptée de la RNase. Par exemple, les RNases immunitaires agissent en déstabilisant les membranes cellulaires des bactéries. [10] [11]

Pour contrer cela, l'équipement utilisé pour l'extraction d'ARN est généralement nettoyé à fond, séparé de l'équipement de laboratoire commun et traité avec divers produits chimiques agressifs qui détruisent les RNases. Pour la même raison, les expérimentateurs font particulièrement attention à ne pas laisser leur peau nue toucher l'équipement.


Voir la vidéo: RNase A (Août 2022).