Informations

Problème de jonction du gène d'intérêt dans le plasmide ouvert lorsque leurs longueurs ne sont pas les mêmes

Problème de jonction du gène d'intérêt dans le plasmide ouvert lorsque leurs longueurs ne sont pas les mêmes



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Avant l'obtention du plasmide recombinant dans l'ADN recombinant, le gène d'intérêt est inséré dans un plasmide linéarisé par l'ADN ligase.

Que se passe-t-il si la longueur du gène d'intérêt n'est pas la même que celle de la brèche dans le plasmide ouvert ? (par exemple beaucoup plus longtemps) Le gène peut-il toujours être connecté à la brèche ou d'autres processus sont-ils nécessaires avant que le plasmide recombinant puisse être réintroduit dans la bactérie ?


D'après votre question, je soupçonne que vous pensez à l'ADN comme étant une molécule très rigide - ce n'est pas le cas.

L'ADN double brin est raisonnablement flexible et un modèle mental utile serait de penser à cela comme à attacher les extrémités de deux morceaux de fil mince ensemble pour former un cercle.

L'ADN double brin peut former des cercles fermés de moins de 250 pb de long1,2 et je ne pense pas qu'il y ait de limite supérieure connue - par exemple, il existe un chromosome bactérien circulaire connu de 14 782 125 pb de longueur3.

Un plasmide typique peut accueillir des inserts de n'importe quelle taille jusqu'à une taille totale d'environ 50 kb, mais les plasmides de plus de 20 kb sont très difficiles à utiliser et peuvent nécessiter des techniques de transformation spéciales.

Les références:

1 : Thibault, Thomas et al. « Production de minicercles d'ADN de moins de 250 paires de bases grâce à un nouveau test de circularisation d'ADN concentré permettant la conception de minicercles avec une activité d'inhibition de NF-κB. » Recherche sur les acides nucléiques vol. 45,5 (2017) : e26. doi: 10.1093/nar/gkw1034

2: Shore, David, Jorg Langowski et Robert L. Baldwin. "La flexibilité de l'ADN étudiée par la fermeture covalente de courts fragments en cercles." Actes de l'Académie nationale des sciences 78.8 (1981): 4833-4837

3 : Terre, Miriam et al. « Aperçus de 20 ans de séquençage du génome bactérien. » Génomique fonctionnelle et intégrative vol. 15,2 (2015) : 141-61. doi:10.1007/s10142-015-0433-4


La transformation plasmidique est un mécanisme par lequel nous pouvons introduire des gènes d'intérêt dans des cellules bactériennes. Pour ce faire, nous isolons un autre plasmide, insérons le gène que nous voulons, puis remettons le plasmide dans les cellules bactériennes.

Nous pouvons isoler le plasmide par divers moyens biochimiques, et les plasmides sont suffisamment petits pour que nous puissions isoler entier plasmides. (Nous avons du mal à isoler des morceaux entiers d'ADN plus long, qui a tendance à se décomposer en fragments.) Une fois que nous avons isolé le plasmide, nous pouvons appliquer des enzymes de restriction (telles que EcoRI) pour les séquences spécifiques que nous voulons sur le plasmide et le gène d'intérêt. Les enzymes de restriction clivent souvent le plasmide et notre gène sur des sites coupés, ce qui laisse des extrémités collées (extrémités de l'ADN avec un brin simple brin entre deux et quatre bases de long). Ces extrémités collantes se lient facilement avec d'autres morceaux d'ADN correspondants de cette manière, nous pouvons joindre le gène d'intérêt dans notre plasmide ou couper d'autres morceaux du plasmide. Après avoir ajouté l'enzyme de restriction, nous ajoutons de l'ADN ligase pour ligaturer le plasmide (pour reformer les liaisons covalentes qui maintiennent l'ADN ensemble).

Une fois que nous avons notre plasmide ligaturé, nous aimerions l'insérer dans des cellules bactériennes. Certaines bactéries sont naturellement compétentes et accepteront simplement les plasmides de leur environnement. Cependant, de nombreuses autres bactéries (telles que E. Coli), ne sont pas naturellement compétents, et nous devons induire la compétence afin de leur faire accepter le plasmide. Il existe des méthodes électriques pour induire la compétence, qui appliquent un champ et ouvrent essentiellement les bactéries afin d'accepter le plasmide bien que la plupart des bactéries meurent, certaines survivent et forment des colonies. Il existe également des méthodes chimiques pour induire la compétence, comme l'ajout de chlorure de calcium à E. Coli, mais leur mécanisme d'action est plus compliqué.

Enfin, une fois que nous avons inséré notre plasmide dans des cellules bactériennes, nous pouvons les faire repousser en colonies. Si nous en avons besoin, nous pouvons appliquer la sélection pour les plasmides recombinants, ce qui est discuté plus loin dans cette amorce technique.


Possibilités d'accès

Obtenez un accès complet au journal pendant 1 an

Tous les prix sont des prix NET.
La TVA sera ajoutée plus tard dans la caisse.
Le calcul des taxes sera finalisé lors du paiement.

Obtenez un accès limité ou complet aux articles sur ReadCube.

Tous les prix sont des prix NET.


Méthodes nécessitant une recombinaison d'ADN dans des cellules de mammifères

La méthode classique pour générer des vecteurs adénoviraux substitués par E1 nécessite une recombinaison entre deux molécules d'ADN, l'une portant des séquences cartographiées à l'extrémité gauche du génome de l'adénovirus et du gène d'intérêt, et l'autre portant des séquences qui chevauchent légèrement le 3'-plus viral séquences sur la première molécule et continuer jusqu'à l'extrémité droite du génome de l'adénovirus. Ces dernières, que nous appellerons séquences d'extrémité droite pour simplifier, peuvent être soit un ADN linéaire purifié à partir de virions, soit un plasmide. Cette recombinaison a lieu à l'intérieur des cellules exprimant E1 telles que les cellules 293, générant l'ADN viral recombinant souhaité.

À l'origine, l'extrémité droite du génome de l'adénovirus était obtenue en digérant l'ADN viral avec une ou des enzyme(s) de restriction qui coupent dans la région E1 (figure 2a).42 En raison de la faible différence de taille entre les ADN viraux non digérés et digérés, il est difficile de vérifier l'intégralité de la digestion par électrophorèse sur gel d'agarose ou de séparer les deux ADN pour la purification. Cela peut être un problème car l'ADN viral non digéré générera le virus plus efficacement que le produit de recombinaison, conduisant à la contamination de la préparation de virus recombinant avec le virus parental. De plus, les petits fragments de restriction qui correspondent à l'extrémité gauche du génome et sont transportés lors de la transfection peuvent religater à l'intérieur de la cellule et générer des adénovirus capables de se répliquer.4344 Par conséquent, deux ou trois cycles de purification par dosage de plaque doivent être effectués, et plusieurs plaques doivent être analysées pour identifier le virus recombinant. Un deuxième inconvénient de cette méthode est que l'événement de recombinaison, qui est nécessaire pour lier les séquences d'adénovirus gauche portant le gène d'intérêt aux séquences d'extrémité droite, est inefficace dans les cellules de mammifère. Par conséquent, il faut généralement jusqu'à 2 semaines pour que le virus recombinant apparaisse.

(a) Construction de vecteurs adénoviraux substitués par E1 par recombinaison classique dans des cellules auxiliaires. Voir le texte pour les explications et la légende de la figure 1 pour les définitions des symboles. La double flèche représente la cassette d'expression. Les virus creux et noirs au bas du panneau indiquent respectivement les virus parentaux et recombinants. (b) Construction de vecteurs adénoviraux substitués par El à partir d'ADN adénoviraux circulaires infectieux. Ori, Amp : origine de réplication colE1 et gène de résistance à l'ampicilline, respectivement. Les tableaux résument les principales caractéristiques des deux techniques et de leurs dérivés. Dans chaque tableau, les caractéristiques mentionnées plus d'une fois sont désignées par des nombres entre parenthèses.

Trois méthodes ont été développées pour faciliter la détection et la purification du virus recombinant. En utilisant un ADN viral dans lequel la région E1 est remplacée par une cassette exprimant la thymidine kinase du HSV (tk),45 la contre-sélection contre le virus de fond parental peut être effectuée en ajoutant du ganciclovir à la couche de gélose. Cette contre-sélection n'est fiable que sur un test de plaque secondaire, cependant, car les plaques primaires obtenues directement après la transfection peuvent provenir de cellules qui ont absorbé plusieurs génomes viraux et contiennent à la fois les tk-le virus parental exprimant et le virus recombinant. De même, l'ADN viral dans lequel la région E1 est remplacée par une cassette exprimant E. coli La β-galactosidase43 ou une protéine fluorescente verte46 peut être utilisée comme ADN parental. Les plaques contenant le virus de fond sont détectées soit par coloration au X-gal, soit par microscopie à fluorescence, respectivement. Ces deux méthodes auraient permis l'isolement du virus recombinant au cours du premier cycle de purification. Il serait cependant plus prudent, et une procédure virologique appropriée, d'effectuer un deuxième cycle de purification de la plaque, comme suggéré pour le tk-exprimant le virus.

Le complexe adénoviral ADN-protéine terminale peut générer des plaques virales avec une efficacité de deux à trois ordres de grandeur supérieure à celle de l'ADN nu préparé avec la protéinase. Pendant des décennies, de tels complexes ont été utilisés pour construire des adénovirus recombinants.47484950 Plus récemment, une technique a été adaptée dans laquelle le complexe ADN-protéine terminale est digéré avec une enzyme de restriction à plusieurs sites du génome Ad5, empêchant ainsi mieux la régénération de la virus parental.51 La cassette d'expression est clonée dans un cosmide contenant une copie complète du génome de l'adénovirus. Le cosmide circulaire et l'ADN viral digéré sont tous deux transfectés dans des cellules auxiliaires. Quelques centaines de plaques, qui surviennent par recombinaison du génome dérivé du cosmide de pleine longueur avec les deux extrémités terminales du génome liées aux protéines, sont généralement obtenues en utilisant cette procédure, parmi lesquelles environ 70 % sont positives pour la présence de la cassette d'expression.

Pour pallier l'inefficacité de la recombinaison homologue dans les cellules de mammifères, une technique a été développée qui utilise le bactériophage P1 Cre-saumon fumé système de recombinaison.52 Ce système est composé de trois éléments : (1) un adénovirus recombinant qui contient deux loxP sites flanquant le signal d'encapsidation (2) un vecteur navette qui contient l'ITR gauche, le signal d'encapsidation, la cassette d'expression et un loxP site (3) une lignée cellulaire dérivée de 293 qui exprime la recombinase du phage P1 Cre. Pour générer des vecteurs adénoviraux substitués par El, le vecteur navette portant le gène d'intérêt et l'ADN viral sont co-transfectés dans les cellules auxiliaires. Premièrement, une recombinaison intramoléculaire se produit entre les deux loxP sites présents dans l'ADN viral. Cela génère un génome d'adénovirus capable de répliquer et d'exprimer des gènes viraux, mais incapable d'être encapsulé. Une seconde recombinaison se produit entre le loxP site de ce produit et celui sur le vecteur navette, générant le virus recombinant souhaité. Le principal inconvénient de cette méthode est la persistance du virus parental dans la préparation, qui peut représenter jusqu'à 30% de la population virale après le premier passage, et constitue encore 0,2% après trois passages. Par conséquent, cette méthode nécessite une vérification minutieuse de l'identité du virus recombinant.

Une amélioration très récente de cette technique a été obtenue en utilisant de l'ADN d'adénovirus isolé à partir de plasmides au lieu de particules virales.53 Un grand plasmide a été construit qui contient le squelette Ad5 dépourvu de l'ITR gauche, le signal d'encapsidation et les séquences E1. Ce plasmide, linéarisé en un site flanquant l'ITR droit, est co-transfecté dans des cellules auxiliaires avec un plasmide navette qui contient les séquences adénovirales gauches et la cassette d'expression. Le virus est généré lors d'une recombinaison d'ADN homologue entre les deux molécules d'ADN. Contrairement aux méthodes décrites ci-dessus, la contamination par le virus parental n'est pas possible et, par conséquent, un nombre limité de plages doit être analysé.

Une autre approche pour construire des vecteurs adénoviraux recombinants repose sur la capacité des ADN adénoviraux circulaires à générer un virus lors de la transfection dans des cellules 293 (Figure 2b).2054 Ces ADN viraux circulaires contiennent un gène de résistance à l'ampicilline et une origine bactérienne de réplication à la place de la région E1. , et sont donc capables de se répliquer dans E. coli comme plasmides. Ces vecteurs ont été modifiés par la suite pour augmenter leur taille à environ 40 kb, ou ont été supprimés pour leur signal d'encapsidation. Ces caractéristiques rendent les molécules parentales incapables d'être encapsidées dans des virions, et par conséquent une préparation de virus recombinant homogène devrait pouvoir être obtenue. Dans ce système, le gène d'intérêt est cloné dans un petit plasmide contenant l'extrémité gauche du génome de l'adénovirus. Le plasmide résultant, linéarisé, est co-transfecté dans des cellules auxiliaires avec le plasmide d'adénovirus circulaire. La recombinaison doit se produire entre les deux ADN pour créer une molécule qui peut être répliquée et emballée pour générer le virus recombinant. La même technique peut être utilisée pour insérer des cassettes d'expression dans la région E3, ou à la fois dans les régions E1 et E3. Cependant, la manipulation de ces gros plasmides dans E. coli est rendue difficile du fait de la présence d'une séquence palindromique longue de 200 pb qui résulte de la juxtaposition des ITR d'adénovirus gauche et droit dans la construction plasmidique. De telles structures sont connues pour être instables dans E. coli et délétère pour la croissance bactérienne.55 De plus, la formation de plaques lors de la transfection d'ADN d'adénovirus circulaire a été signalée comme étant inefficace,41 probablement parce que les ITR d'adénovirus incrustés initient moins efficacement la synthèse d'ADN que ceux aux extrémités de l'ADN linéaire.56 une lignée exprimant constitutivement la protéine préterminale de l'adénovirus et l'ADN polymérase peuvent être utilisées pour surmonter ce problème de réplication.41

Quant aux techniques utilisant des ADN viraux linéaires, cette méthode de recombinaison homologue a été améliorée en utilisant le Cre-saumon fumé système de recombinaison. Dans un premier mode de réalisation, saumon fuméDes sites P ont été insérés à la fois dans le grand ADN d'adénovirus circulaire et dans le petit plasmide navette.57 L'adénovirus recombinant est obtenu à la suite d'une recombinaison médiée par Cre entre les deux plasmides après leur cotransfection dans une lignée cellulaire 293 exprimant la recombinase Cre. La fréquence de sauvetage du virus à l'aide de ce système de recombinaison spécifique est significativement plus élevée (environ 30 fois) que par in vivo recombinaison homologue. Dans un deuxième mode de réalisation, la région E1 de la forme circulaire de l'ADN d'adénovirus est remplacée par un vecteur cosmidique flanqué de loxP sites.58 Comme ci-dessus, ce remplacement produit une molécule d'ADN trop grande pour être emballée dans des virions. Des cassettes d'expression sont insérées entre les loxPle squelette cosmidique flanqué et le génome de l'adénovirus via l'encapsidation dans le phage . Le cosmide résultant est transfecté dans des cellules auxiliaires qui expriment la recombinase Cre. Un intramoléculaire Cre-saumon fumé la recombinaison médiée excise le squelette du vecteur cosmidique et produit une molécule qui peut être emballée dans des virions. En utilisant cette méthode, des plaques virales sont observées entre 8 et 10 jours après la transfection.


Résultats

Inactivation efficace du gène du pigment olvA dans A. niger par le système CRISPR/Cas9 incarné par l'élément HH-sgRNA-HDV

Tester la faisabilité et l'efficacité du système CRISPR/Cas9 en A. niger, nous choisissons de cibler les olvA gène qui peut être facilement criblé phénotypiquement après inactivation. olvA Le gène code pour l'homologue de l'hydrolase YWA1 et sa délétion peut former des conidies olive sur milieu de régénération tandis que la souche sauvage présente des conidies noires. A 20 pb de la séquence protospacer avec le 3'-PAM AGG pour olvA a été choisi au début de l'ORF (nucléotide −18 à −37). Les plasmides résultants pAN1 ont été transformés en A. niger par transformation de protoplastes. La plupart des transformants (24/26) cultivés sur des plaques d'hygromycine (Fig. 4a) ont montré le phénotype souhaité des colonies d'olives, avec un taux de mutation de plus de 90 %. Parce que les conidies de A. niger contiennent deux noyaux ou plus, l'isolement d'une seule colonie mutante des transformants d'origine est nécessaire. Nous avons dilué les conidies des transformants primaires à 10 4 – 10 5 fois et strions le diluant de conidies sur milieu avec de l'hygromycine pendant 3 jours pour isoler les homozygotes (Fig. 4b). Ensuite, l'ADN du génome extrait de la seule colonie positive a été utilisé comme matrice pour la PCR et l'identification de l'ADN. Les résultats du séquençage reflétaient soit la délétion d'un seul nucléotide, soit la mutation en amont du motif PAM dans olvA gène dans les deux transformants (tableau 2).

Primaire et la deuxième génération de transformants dans lesquels olvA a été inactivé par le système CRISPR/Cas9. une Croissance de la souche de type sauvage (WT) et des mutants ΔolvA. b Croissance d'une seule colonie propagée à partir des transformants primaires

Surexpression de glaA et la régulation à la baisse de agdF en une seule étape par CRISPR

Après transformation par le plasmide pAN-agdF et fragment de réparation contenant glaA cassette d'expression et bras de 1 kb homologues à agdF, A. niger des colonies résistantes à l'hygromycine ont été obtenues. Une vérification par PCR des parties haut et bas de l'insertion (Fig. 3b) dans le génome des transformants positifs a été réalisée. Le résultat montre (Fig. 3c) trois candidats sur cinq possédant le fragment d'insertion. L'un des trois a été choisi comme agdF::glaA mutant pour un autre test d'activité enzymatique. Comme le montre la figure 5, l'activité de la glucoamylase de agdF::glaA mutant était 25,9 % plus élevé que la souche sauvage, tandis que l'activité de la -glucosidase de agdF::glaA mutant était 61,4 % inférieur à la souche sauvage.

La comparaison de l'activité enzymatique entre la souche sauvage et le mutant agdF::glaA. une Comparaison de l'activité de la glucoamylase. b Comparaison de l'activité de la -glucosidase (m = 5, *p < 0.05)

Efficacité du remplacement du gène avec différentes longueurs du bras homologue

Pour tester la relation entre l'efficacité du remplacement du gène et la longueur des bras homologues, nous avons en outre conçu les fragments de réparation avec 2 ensembles de longueurs de bras différentes (500 et 100 pb) sur la base de l'expérience mentionnée ci-dessus. Nous avons co-transformé le plasmide pAN-agdF et les fragments de réparation avec différentes longueurs de bras homologues. Après co-transformation, nous avons sélectionné 3 ou 5 transformants de chaque transformation et extrait leur ADN génomique pour identification par PCR. Et nous avons trouvé que tous les transformants testés (3/3 et 5/5, respectivement) étaient positifs. Les résultats de la PCR (Fig. 6) ont démontré qu'une paire de bras d'homologie de 100 pb est suffisante pour obtenir une intégration homologue stimulée par le système CRISPR/Cas9 dans A. niger avec une grande efficacité.

Vérification du génotype par PCR dans les transformants sélectionnés après co-transformation de fragments de réparation avec différentes longueurs de bras homologues. La longueur attendue pour le produit amplifié des mutants agdF::glaA était d'environ 820 pb pour la PCR en amont et en aval, alors qu'aucune bande ne sera produite à partir de la souche de type large CBS513.88. une Résultats de PCR utilisant un bras homologue de 500 pb. Les résultats ont montré que les 3 candidats testés avaient le génotype attendu. b Résultats de PCR utilisant un bras homologue de 100 pb. Les résultats ont montré que les 5 candidats testés avaient le génotype attendu


MATÉRIAUX ET MÉTHODES

Culture de cellules

Les cellules de rein embryonnaire humain (HEK293) (Invitrogen) ont été cultivées dans du DMEM additionné de 10 % de sérum de veau foetal (FCS). Les cellules HEK293 ont exprimé de manière constitutive le gène E1 supprimé par Adeasy en trans. Des particules virales infectieuses ont été produites après que ces cellules ont été transfectées avec des vecteurs adénoviraux délétés par El. Après infection par les adénovirus recombinants, les cellules ont été maintenues dans du DMEM supplémenté avec 5% de FCS.

Bactéries, plasmides et ADN viral

E. coli les souches DH10β et BUN21 et le plasmide pML300 ont été gracieusement offerts par le professeur Stephen J Elledge de la Harvard Medical School à Boston (MA, USA) (18). DH10a a été utilisé pour générer le plasmide donneur recombinant et BUN21 a été utilisé pour générer et propager les plasmides adénoviraux recombinants. Le plasmide pML300 contenu dans BUN21 porte le gène de la recombinase rouge et gam induit par le rhamnose, et est incapable de se répliquer lorsque les bactéries sont cultivées à 42°C (18). Le plasmide MAGIC1 et le plasmide 1202 ont également été fournis par le Pr Stephen J Elledge (18). Le vecteur osseux adénoviral (pAdeasy) et le plasmide pShuttle ont été obtenus auprès de Stratagene (15). Nous avons construit le nouveau plasmide donneur pRTRA (figure 1), le plasmide receveur pAd-pheS (génome adénoviral complet), le plasmide pPic-man et le plasmide pShuttle-cmv-red-sv40polA.

Clonage des gènes étrangers gfp et homme dans le plasmide donneur en utilisant l'enzyme de restriction Bsu36I et l'ADN polymérase T4

Les gfp gène a été amplifié à partir de pEGFP-1 (Clontech) par PCR. L'amorce directe était 5'-TTAC GATGGTGAGCAAGGGCGAGGA-3', et l'amorce inverse était 5'-TGAC TTACTTGTACAGCCTCGTCCATGCC-3'. Les homme Le gène a été amplifié à partir de pPic-man en utilisant les amorces : ZL15F, 5'-TTACT GAAGCGCATACTGTGTCGCC-3′ et ZL16R, 5'-TGAC CGGATTCACTCAACGATTGG-3′. Les fragments amplifiés ont été incubés avec 0,5 U d'ADN polymérase T4 et 4 mM de dGTP (TaKaRa) à 12°C pendant 45 min, comme décrit précédemment (19, 20). Pour chaque gène, un total de 30 ng de fragments traités et 1 ng de pRTRA digéré par Bsu36I (CCTTAGG et CCTGAGG) ont été ligaturés avec 5 U de T4 DNA ligase™ (TaKaRa) à 16°C pendant 12 h dans 1 l de tampon . Les gfp gène et homme ont été insérés dans pRTRA pour former séparément les plasmides pRTGA et pRTMA (figure 2).

Modification du plasmide donneur

Le fragment de gène de résistance au chloramphénicol a été amplifié à partir de pBT (Strategene) par PCR en utilisant l'amorce sens [5′-TTT GTCGACATAACTTCGTATAATGTATGCTATACGAAGTTAT ACGGGGAGAGCCTGAGCCAAC (SalI et 34 pb sites loxP soulignés)] et l'amorce inverse [5′-TTTGCATTCATTG CATTGATGAGCACTAGCACTAGCACTAGCATG (ApaLI, 34 pb sites loxP soulignés)]. La PCR a été réalisée à 95°C pendant 5 min, suivie de 25 cycles à 95°C pendant 45 s, 56°C pendant 45 s et 72°C pendant 1 min en utilisant le Thermo Hybrid PX2 (Thermo) et la polymérase TaKaRa Extaq™ (TaKaRa). Le fragment coupé par ApaLI et Sali a été ligaturé dans le vecteur pRTRA (également coupé par les mêmes enzymes), aboutissant au plasmide recombinant pRTRC.

Génération du vecteur adénoviral recombinant par MAGIC

La stratégie globale élaborée est illustrée à la figure 3 . E. coli DH10β contenant le vecteur donneur pRTRA a été cultivé dans un bouillon Luria-Bertani (LB) contenant de l'ampicilline (100 g/ml). La souche receveuse BUN21 contenant le plasmide pML300 et le plasmide receveur pAd-pheS a été cultivée dans un bouillon LB contenant de la spectinomycine (50 g /ml), kanamycine (50 g/ml) et glucose (0,2% p/v) pendant la nuit. La souche receveuse a été lavée deux fois avec 2 volumes de bouillon LB le lendemain. Les souches donneuses et receveuses ont été diluées séparément à 1:25, 1:50, 1:100 ou 1:200 avec du bouillon LB contenant 0,2% p/v de rhamnose et cultivées à 30°C pendant 2 h jusqu'à un A 600 de 0,15∼0,25, et les souches donneuse et receveuse ont été mélangées à un rapport de 1:1 en fonction de leur A 600 en présence de 0,2 % p/v de l -arabinose. Le mélange a été incubé à 37°C pendant 2 h sans agitation, puis pendant encore 2 h avec agitation. La culture recombinante a été diluée au rapport de 1:100, étalée sur des plaques sélectives contenant de la kanamycine (50 g/ml), de l'ampicilline (100 g/ml), 10 mM de Cl-Phe et 0,2% w/vl d'arabinose, et enfin incubé à 42°C pendant une nuit (18).

Production d'adénovirus recombinants et prolifération

Les plasmides adénoviraux recombinants ont été amplifiés en incubant la colonie identifiée dans 50 ml de bouillon LB contenant de la kanamycine (50 µg/ml), de l'ampicilline (100 µg/ml) et 0,2 % p/v d'arabinose. La culture a été cultivée pendant une nuit à 37°C. L'ADN maxiprep a ensuite été préparé à partir de la culture liquide et digéré en quantité suffisante (5 µg d'ADN) avec PacI. Par la suite, le tampon et l'excès d'enzyme des réactions de restriction ont été éliminés par extraction au phénol/précipitation à l'éthanol. L'ADN a été remis en suspension dans 50 l de tampon stérile 0,1 × TE ou dH 2 O, puis ajouté aux cellules HEK293 en présence de Lipofectamine 2000 (Invitrogen). A 4 h post-transfection, les cellules ont été incubées dans 5 ml de DMEM contenant 5% de FCS. Environ 8 jours après la transfection, les cellules ont été récoltées et sédimentées par centrifugation à basse vitesse, et les virus ont été libérés par trois cycles de congélation/décongélation. Le lysat cellulaire [1 ml dans 1X tampon phosphate (PBS) (pH 7,4)] contenant les adénovirus recombinants a ensuite été amplifié et purifié. Pour générer des stocks viraux à titre plus élevé, les cellules HEK 293 ont été infectées par le lysat cellulaire et le processus de récolte a été répété.

Construction d'une bibliothèque modèle d'expression d'ADNc adénoviral

La souche donneuse contenant pRTRA et la souche donneuse contenant pRTGA ont été mélangées à des ratios de 1:30, 1:300, 1:3000 et 1:30 000 sur la base de leur A 600 . Les colorants donneurs mélangés à différents ratios ont été mélangés avec la souche receveuse à un ratio 1:1 sur la base de leur A 600 (3, 18). Les expériences ultérieures étaient basées sur la procédure MAGIC complète comme indiqué précédemment (18). Le bouillon LB a été utilisé pour laver toutes les colonies sur les plaques sélectives qui ont ensuite été incubées pendant une nuit dans 100 ml de bouillon LB contenant 50 g/ml de kanamycine, 100 g/ml d'ampicilline, 0,2 % p/v l -arabinose et 10 mM Cl-Phe. L'ADN a été extrait pour de meilleurs rendements, traité avec Pacl, et l'excès de tampon et d'enzyme a été éliminé par extraction au phénol/précipitation à l'éthanol. L'ADN (5 g) a été remis en suspension dans 100 l de tampon stérile 0,1× TE ou dH 2 O, puis ajouté à une plaque de 60 mm contenant 1 × 10 6 cellules HEK293 qui avaient été incubées dans du DMEM avec 5 % de FCS pendant 2 h. A 4 h post-transfection, les cellules ont été incubées pendant 8 jours dans 5 ml de DMEM contenant 5% de FCS. Après trois cycles de congélation-décongélation, le lysat résultant (1 ml) a été utilisé pour infecter les cellules HEK 293 dans une plaque de 10 cm (70 % de confluence) pendant 1 h avant d'être incubé avec 5 ml de DMEM additionné de 5 % de FCS.


La logique des éléments génétiques égoïstes

Bien que les éléments génétiques égoïstes montrent une diversité remarquable dans la manière dont ils favorisent leur propre transmission, certaines généralisations sur leur biologie peuvent être faites. Dans une critique classique de 2001, Gregory D.D. Hurst et John H. Werren ont proposé deux "règles" d'éléments génétiques égoïstes.[4]

Règle 1 : La propagation d'éléments génétiques égoïstes nécessite des relations sexuelles et des croisements

La reproduction sexuée implique le mélange des gènes de deux individus. Selon la loi de ségrégation de Mendel&# x02019, les allèles d'un organisme se reproduisant sexuellement ont 50 % de chances d'être transmis du parent à la progéniture. La méiose est donc parfois appelée �ir”.[30]

On s'attend à ce que les génomes hautement autofertiles ou asexués connaissent moins de conflits entre les éléments génétiques égoïstes et le reste du génome hôte que les génomes sexuels croisés. [31&# x0201333] Il y a plusieurs raisons à cela. Premièrement, le sexe et l'allogamie placent des éléments génétiques égoïstes dans de nouvelles lignées génétiques. En revanche, dans une lignée hautement autofécondée ou asexuée, tout élément génétique égoïste est essentiellement coincé dans cette lignée, ce qui devrait augmenter la variation de la forme physique entre les individus. La variation accrue devrait se traduire par une sélection purificatrice plus forte chez les selfers/asexués, car une lignée sans les éléments génétiques égoïstes devrait concurrencer une lignée avec l'élément génétique égoïste. Deuxièmement, l'homozygotie accrue chez les autogames supprime la possibilité de compétition entre les allèles homologues. Troisièmement, des travaux théoriques ont montré que le plus grand déséquilibre de liaison dans l'autofécondation par rapport aux génomes allocroisés peut dans certains cas, bien que plutôt limités, entraîner une sélection pour des taux de transposition réduits.[34] Dans l'ensemble, ce raisonnement conduit à prédire que les asexuels/les autodidactes devraient faire l'expérience d'une charge plus faible d'éléments génétiques égoïstes. Une mise en garde à ce sujet est que l'évolution de l'autofécondation est associée à une réduction de la taille effective de la population.[35] Une réduction de la taille effective de la population devrait réduire l'efficacité de la sélection et conduit donc à la prédiction inverse : une accumulation plus élevée d'éléments génétiques égoïstes chez les autogames par rapport aux allocroissants. Les preuves empiriques de l'importance du sexe et de l'allogamie proviennent d'une variété d'éléments génétiques égoïstes, y compris des éléments transposables,[36,37] des plasmides auto-promotionnels,[38] et des chromosomes B.[39]

Règle 2 : La présence d'éléments génétiques égoïstes est souvent révélée chez les hybrides

La présence d'éléments génétiques égoïstes peut être difficile à détecter dans les populations naturelles. Au lieu de cela, leurs conséquences phénotypiques deviennent souvent apparentes chez les hybrides. La première raison en est que certains éléments génétiques égoïstes passent rapidement à la fixation, et les effets phénotypiques ne seront donc pas ségrégués dans la population. Les événements d'hybridation, cependant, produiront une progéniture avec et sans les éléments génétiques égoïstes et révéleront ainsi leur présence. La deuxième raison est que les génomes de l'hôte ont développé des mécanismes pour supprimer l'activité des éléments génétiques égoïstes, par exemple le petit ARN administré pour faire taire les éléments transposables.[40] La co-évolution entre les éléments génétiques égoïstes et leurs suppresseurs peut être rapide et suivre une dynamique de reine rouge, qui peut masquer la présence d'éléments génétiques égoïstes dans une population. La descendance hybride, en revanche, peut hériter d'un élément génétique égoïste donné, mais pas du suppresseur correspondant et ainsi révéler l'effet phénotypique de l'élément génétique égoïste.[41,42]


Carte de restriction et résumé virtuel

Les cartes d'ADN sont des représentations simplifiées de séquences nucléotidiques, montrant des caractéristiques d'un intérêt particulier telles que des gènes. Les cartes de restriction sont des cartes d'ADN qui montrent des sites de restriction, les emplacements où des enzymes de restriction spécifiques couperont l'ADN. Voici une carte de pGLO :

J'ai réalisé cette carte avec Benchling, le logiciel en ligne que j'utilise habituellement pour analyser les séquences nucléotidiques. Certaines des caractéristiques de cette carte pGLO devraient vous sembler familières, telles que le gène de résistance à l'ampicilline (AmpR) et le gène GFP. Sont également inclus des sites de restriction pour trois enzymes que nous avons en laboratoire : HindIII, PvuI et EcoRI. Cette carte vous donnera une idée générale de la taille des fragments d'ADN à laquelle vous devez vous attendre si vous coupez pGLO avec chacune de ces enzymes :

  • PvuI: Coupe une fois, donc vous obtenez un morceau linéaire, la taille du plasmide entier (5371 pb).
  • EcoRI: Coupe une fois, vous obtenez donc un morceau linéaire, de la taille de l'ensemble du plasmide (5371 pb). Bien qu'EcoRI coupe à un endroit différent de PvuI, le fragment résultant sera de la même taille.
  • HindIII: Coupe deux fois, vous obtiendrez donc un petit morceau et un grand morceau.

Supposons maintenant que vous vouliez couper le plasmide avec plus d'une enzyme à la fois. Chaque enzyme agira sur ses propres sites de restriction, de sorte que les différentes enzymes ne s'affecteront pas les unes les autres. Sur la carte ci-dessus, vous pouvez voir que si vous coupez à la fois avec EcoRI et HindIII, vous couperez un petit morceau entre les sites EcoRI et HindIII, vous ne pourrez probablement pas voir ce petit fragment sur un gel, donc ce n'est pas utile d'effectuer ce condensé. Supposons que vous coupiez avec PvuI et EcoRI ensemble. En utilisant cette carte légèrement plus détaillée (avec l'aimable autorisation de Snapgene), vous devriez être en mesure de prédire les tailles exactes des fragments d'ADN que vous obtiendrez :

Cette carte montre les emplacements exacts des sites de restriction. Chaque nucléotide se voit attribuer un numéro, basé sur un point de départ choisi arbitrairement. Si PvuI coupe au nucléotide 3054 et EcoRI au nucléotide 2063, et que le plasmide circulaire entier a une longueur de 5371 pb, vous pouvez probablement déterminer la taille des fragments que vous obtiendrez.

Malheureusement, la carte ci-dessus laisse de côté les sites HindIII (je ne sais pas pourquoi ils n'ont pas été inclus).

Effectuer des résumés virtuels de pGLO

En utilisant les enzymes de restriction que nous avons en laboratoire, la meilleure combinaison pour obtenir des fragments de pGLO bien espacés sur votre gel serait HindIII et PvuI. Pour déterminer les résultats attendus du condensé HindIII + PvuI, vous pouvez utiliser un logiciel de cartographie de restriction tel que celui-ci :

Pour un condensé de restriction électronique précis, vous devez entrer la séquence nucléotidique de l'ADN que vous allez couper. Trouvez la séquence pGLO (la séquence originale de Bio-Rad) sur la page Sequence Data (gardez cette page ouverte dans un autre onglet, vous l'utiliserez à nouveau).

Copy the whole sequence, including the numbers, and paste it into the "sequence info" box in the Restriction Analyzer (the software will ignore the numbers and spaces, and only look at the nucleotide sequence). Note that the sequence is shown for only one strand of DNA, but the software is smart enough to recognize that the actual DNA is double-stranded. Check "Circulaire" under Conformation, and then go to the Include box and select PvuI. Cliquer sur Virtual Digest.

Virtual digest will take you to a page showing the complete nucleotide sequences of the DNA fragments produced in the digest (which you probably don't care about) and also the length of each fragment (which you will be able to verify on your gel. Those fragment lengths are your expected results for this experiment.

Repeat the virtual digest procedure for the enzyme SspI.

Alternative approach: You could also use Benchling instead of RestrictionMapper. Benchling is more modern and more powerful, but it takes a little while to learn and you will have to sign up for a (free) account. Personally, I use Benchling for most of my sequence work, and I recommend it.

Make your own map of pGLO

Draw your own simplified map of pGLO. Show the exact cut sites for PvuI and SspI. Also include the approximate locations of the GFP, AmpR (ampicillin resistance, also called β-lactamase or bla), and AraC genes.

Perform virtual digests of pGLO non-fluorescent mutant

The Bio 6B Special Projects students accidentally created a mutant version of pGLO that doesn't have a functional GFP gene. Find the sequence for the pGLO Non-Fluorescent Mutant on the sequence page.

Perform virtual digests of this sequence the same way you did with the original pGLO sequence. You should get a slightly different result for one of the enzymes.

On the pGLO map, show where the mutant sequence differs from the original.

Perform a virtual digest of lambda

Lambda bacteriophage is the DNA you'll use as a molecular weight marker. This DNA is widely available gets cut into a range of predictably sized fragments, making it one of the most common molecular weight markers.

Find the sequence of lambda on the Sequence Data page. The lambda genome is linear DNA, unlike the circular plasmids.

Perform a virtual digest of lambda with the enzyme Hind III and write down the fragment sizes. Unlike the plasmids, lambda DNA is linear, so check the appropriate box before doing the digest.

Diagram the gel results

Draw a labeled picture of the expected gel results for the following restriction digests:

  • pGLO Green cut with PvuI
  • pGLO Green cut with SspI
  • pGLO Non-Fluorescent cut with PvuI
  • pGLO Non-Fluorescent cut with SspI
  • Lambda DNA cut with Hind III

Draw a diagram of the gel showing the relative positions of the bands, and label each band with its size in base pairs. This will represent your expected results for the actual digest that you perform.

How much DNA per band?

If you perform a restriction digest and run it on a gel, you'd like to be able to see all the bands. Your ability to see a band on the gel depends on how many nanograms of DNA are in that band, as well as how you stain the DNA. We use ethidium bromide in our gels, which allows us to visualize individual bands containing as little as 50 ng. However, the different bands from a digest won't have the same mass of DNA. If you cut some DNA into two fragments and one fragment is twice as large as the other, the larger fragment will have twice the mass of the smaller fragment.

Suppose you are doing a restriction digest of lambda using the enzyme Hind III. If you start with 500 ng of uncut lambda DNA, how many nanograms of DNA will be in each of the bands on your gel? Label the bands in the Lambda/Hind III lane of your gel diagram with the amount in nanograms. Do you think you'll be able to see the smallest band?

What to turn in

Working with your lab partners, make one pGLO map (showing cut sites for both the unmutated and mutated versions) and one gel picture for your lab group. Label the gel diagram in terms of base pairs and (for Lambda/Hind III only) nanograms. Turn the diagrams in today in lab, with the names of everyone who worked on it. This counts as a quiz.


Gene (genome) editing to produce genetically modified animals with gene knock-out or knock-in

The initial methods used to generate transgenic livestock resulted in random transgene insertion [10] therefore, new technologies are needed to enable better gene targeting with a higher efficiency in livestock. Although it is conceptually simple to deliver DNA into a fertilized egg via pronuclei injection, this method is technically challenging and the injected DNA construct is integrated randomly into the genome, resulting in unpredictable transgene expression profiles. In addition, microinjection can damage the zygote and requires expensive equipment. These short-comings can be partly overcome by the development of gene (genome) editing approach, which uses a designer nuclease (as a pair of molecular scissors) to generate a double strand break (DSB) in DNA at a desired genomic locus (Fig. 5). Thereafter, one of two endogenous repair mechanisms may repair the DSB DNA: non-homologous end joining (NHEJ) and the homology-directed repair (HDR) [38]. In the error-prone NHEJ pathway, the two ends of the DSB DNA are brought together and ligated without a homologous template for repair, which often inserts or deletes nucleotides (indels). If an indel results in a frame shift mutation, the target gene may lose function (knockout). The HDR pathway requires the provision of an exogenous DNA template along with a site-specific genome editing nuclease to repair the DSB DNA, thereby causing the knock-in of a desired sequence of DNA into the genome of an embryo or animal cells [67]. In practice, modification of a targeted gene is commonly achieved by microinjecting, into an embryo obtained by in vitro fertilization or intracytoplasmic transfer, a gene editing system that consists of a guide RNA and the Cas9 endonuclease, and, if necessary, a repair DNA template [68]. The guide RNA provides sequence specificity to target the Cas9 endonuclease to a complementary site in the genome for creating a DSB.

Gene (genome) editing of animals using the ZFN, TALEN or CRISPR/Cas9 technique. a designer nuclease (ZFN, TALEN or CRISPR/Cas9) cleaves a DNA molecule to generate a double strand break (DSB) at a desired genomic locus. Thereafter, one of two endogenous repair mechanisms may repair the DSB DNA: non-homologous end joining (NHEJ) and the homology-directed repair (HDR). In the NHEJ pathway, the two ends of the DSB DNA are brought together and ligated without a homologous template for repair, which often inserts or deletes nucleotides (indels) to cause gene disruption (knockout). The HDR pathway requires the provision of an exogenous DNA template along with a site-specific genome editing nuclease to repair the DSB DNA, thereby causing the knock-in of a desired sequence of DNA into the genome of an embryo or animal cells. Because of its more precise targeting of genes, CRISPR/Cas9 is gaining momentum in life sciences as the preferred editor of gene editing of livestock species

An earlier designer nuclease was zinc finger nuclease (ZFN the first gene editing tool), and a subsequently discovered designer nuclease is transcription activator-like effector nuclease (TALEN, the second gene editing tool), both of which are modular proteins containing an adaptable DNA-binding domain. The ZFN method involves engineering a protein that contains both a zinc finger DNA-binding domain and a restriction endonuclease domain. The TALEN approach utilizes engineered enzymes containing a DNA-binding domain and a separate DNA-cleaving domain. In recent years, CRISPR (clustered regularly interspaced short palindromic repeats)-associated nuclease-9 (CRISPR/Cas9) has been used as a designer nuclease to provide a more efficient, more accurate, more versatile, more robust, and simpler tool in genomic engineering [19, 62]. ZFN, TALEN, or CRISPR/Cas9 components are delivered into target cells through transfection (lipid-based agents, electroporation, nucleofection, or microinjection) or bacteriophages, depending on cell type and plasmid [69,70,71].

TALENs and CRISPR/Cas9 were first successfully used in pigs in 2013 [72] and 2014 [59, 73], respectively. Over the past 5 years, CRISPR/Cas9 has rapidly gained momentum as the favored gene editor for livestock species. The CRISPR-Cas9 system was discovered in 2007 in bacteria (e.g., a genus of gram-positive cocci or spherical bacteria) and archaea, and is used naturally to defend against invading viruses (bacteriophages). In response to a viral infection, the bacterial CRISPR/Cas9 is guided by a short RNA fragment known as a guide RNA to snip off a piece of viral DNA, creating a DSB in its target loci [68]. The guide RNA is complementary to a segment of the genome of the targeted organism, so that the Cas9 nuclease will cleave DNA with a high degree of specificity. Of note, recognition of the target DNA by Cas9 is dependent on the presence of a short protospacer adjacent motif (PAM) sequence located directly downstream on the untargeted DNA strand [38]. Thus, the CRISPR system consists of two components (a Cas9 endonuclease and a guide RNA) as a ribonucleoprotein. Experimentally, the guide RNA can be designed using molecular biology tools in the laboratory to direct Cas9 to a specific DNA sequence for cleavage at virtually any genomic locus. The milestones for the use of CRISPR/Cas9 in producing gene-edited swine are shown in Table 2.

Advantages and applications

Traditional livestock breeding is beset with such problems as long breeding cycles and limitations of genetic resources. In contrast, genome editing tools can provide more precise, more specific, more predictable and more rapid solutions to solving these problems at relatively affordable costs [38]. Thus, besides knocking out gene function, CRISPR can be employed to delete large DNA fragments from the genome of an animal. Furthermore, a gene editing technique requires fewer steps and has a higher efficiency than the previous methods of animal transgenesis. For example, studies with livestock zygotes have shown a 30% editing frequency with ZFN, TALEN and CRISPR/ Cas9 techniques [19, 72,73,74,75,76,77]. Compared to other gene silencing techniques such as RNAi and antisense RNA, CRISPR/Cas9 offers a higher efficiency, an ability to cleave methylated loci, greater ease of design, and greater flexibility [68]. It should be borne in mind that knockout of a gene provides a cleaner phenotype than its knockdown and that production of knockout pigs does not necessarily require application of a genome editing system. Several laboratories have reported success with producing gene-edited pigs, which can potentially serve as organ donors, disease models, bioreactors, inactivation of porcine endogenous retrovirus in pigs, or founder animals of genetic lines with enhanced productivity (e.g., muscle growth) or disease resistance traits [59,60,61,62,63,64]. Thus, gene editing increases successes in single-gene and multi-allelic modifications of the livestock genome, as well as in site-specific introductions of foreign genes during embryogenesis.

There are many examples for the genome editing-based production of transgenic pigs with important production and disease-resistance traits, including nutrient utilization and meat production as well as resistance to viral infections and metabolic disorders (Table 3). First, disruption of the myostatin (a negative regulator of myogenesis) gene using TALEN as an editor successfully created myostatin-knockout pigs, which exhibited a double-muscled phenotype, greater body weight, greater longissimus muscle mass, and a 100% increase in the number of muscle fibers than wild-type pigs [78]. Second, utilizing the CRISPER/Cas9 technology, Zheng et al. [79] produced pigs with a functional uncoupling protein 1 (UCP1). UCP1 is expressed in the brown adipose tissue of many animal species and is responsible for nonshivering thermogenesis, thereby playing a crucial role in protecting against cold and regulating energy homeostasis. However, modern pigs lack functional UCP1 genes and are therefore susceptible to cold stress, resulting in a high rate of neonatal mortality, and also spontaneous accumulation of a large amount of white adipose tissue in the body, leading to reduced production performance [3]. Of note, insertion of the mouse adiponectin-UCP1 gene into the porcine endogenous UCP1 locus via the CRISPR/Cas9 as an editor can generate UCP1-knockin pigs that exhibit an improved ability to maintain body temperature, a decreased white fat mass, and an increased lean carcass yield [79]. Third, CRISPR/Cas9 gene targeting and SCNT technologies have been used to create pigs without the CD163 gene that encodes a cellular receptor for the porcine reproductive and respiratory syndrome virus-1 (PRRSV-1, also referred to as “blue ear disease” virus) [59]. Whitworth et al. [60] reported that pigs with the CD163 knock-out were fully resistant to the PRRSV-1 (European strain) and PRRSV-2 (North American strain). Similar results were observed by Burkard et al. [63] against both PRRSV-1 and PRRSV-2, and by Yang et al. [64] against a highly pathogenic PRRSV strain (belonging to the North American strain) isolated in South China. Interestingly, Wells et al. [61] found that genetically modified pigs, which were produced through the replacement of porcine CD163 scavenger receptor cysteine-rich domain 5 with a CD163-like homolog, were resistant to PRRSV-1 but not to PRRSV-2. Males and females can be used as breeding stocks to produce generations of PRRSV-resistant offspring.

Désavantages

Although the ZFN method provided the first breakthrough in site-specific gene editing, it has some limitations, such as off-target cutting of the DNA, cytotoxicity, expensive, time-consuming, low efficiency (thus only one genomic edit at a time), and technical challenges to prepare effective ZFN tools [38]. Compared with the ZFN editor, the TALEN technique is more flexible in genetic engineering because its DNA-binding domain can target a wider range of DNA sequences. Although the TALEN editor is easier to design than the ZFN, the TALEN method is expensive and technically difficult when the goal is to simultaneously make multiple edits to the genome [68]. In addition, delivering the gene-editing Cas9 directly to embryos by microinjection remains a challenging process, and microinjection itself may damage the embryos. Compared to the ZFN and TALEN, CRISPR/Cas9 is known to have a higher frequency of off-target effects [80]. Another major obstacle to the use of the CRISPR/Cas9 technology for generating gene-edited animals is the problem of mosaicism (the presence of more than one genotype in one individual) that is common in founder animals [68]. Furthermore, for all currently available gene-editing methods, the rates of prenatal mortality in gene-edited fetuses are much greater than those for control fetuses. To date, the efficiency of gene editing in livestock, including swine, remains suboptimal. The procedures for gene editing should be easier and cheaper, so that more producers can utilize this innovative technique on their own farms for improving animal breeding.


REMERCIEMENTS

This work was supported by the Slovenian Research Agency under grant agreement no.(Z2-7257) and was in part carried out at the Faculty of Health Sciences, University of Primorska, Izola, Slovenia. I kindly thank Maria Pilar Garcillán-Barcia, Fernando de la Cruz (UNICAN, Spain), and Joshua Ramsey (Curtin Univ., Australia) for sharing and discussing data, Filip Buric (Chalmers Univ. of Tech., Sweden) for commenting on the manuscript, and Tomaz Pisanski (UP-FAMNIT, Slovenia) and Ales Lapanje (IJS, Slovenia) for helpful discussions in their respective fields of research.


Voir la vidéo: ELECTROPHORESE SUR GEL DAGAROSE. Séparation et analyse des acides nucléiques. Biochimie Facile (Août 2022).